Mutagenetix > Incidental Mutations

Incidental Mutation 'R6411:Vmn1r88'

514598

Institutional Source

Beutler Lab

Gene Symbol

Vmn1r88

Ensembl Gene

ENSMUSG00000095902

Gene Name

vomeronasal 1 receptor, 88

Synonyms

MMRRC Submission

044384-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R6411 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

13177719-13178669 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 13178043 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 109 (I109F)

Ref Sequence

ENSEMBL: ENSMUSP00000128946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171783]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122190

Predicted Effect

probably damaging
Transcript: ENSMUST00000171783
AA Change: I109F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128946
Gene: ENSMUSG00000095902
AA Change: I109F

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	306	2e-14	PFAM
Pfam:V1R	35	301	1.4e-30	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Capn7	A	G	14: 31,340,096	E55G	probably benign	Het
Carmil2	G	T	8: 105,697,026	D1211Y	probably damaging	Het
Carns1	G	T	19: 4,166,464	A573E	probably damaging	Het
Dennd4a	A	G	9: 64,871,899	R555G	probably benign	Het
Guf1	T	C	5: 69,560,511	I204T	possibly damaging	Het
Hgsnat	C	T	8: 25,946,275	V584M	possibly damaging	Het
Izumo2	A	T	7: 44,719,760	Q186L	probably benign	Het
Lmtk2	A	T	5: 144,174,586	Q708L	probably damaging	Het
Mitf	T	C	6: 98,010,472		probably null	Het
Myo9b	T	A	8: 71,322,955	Y340*	probably null	Het
Naip5	A	G	13: 100,223,405	I441T	probably benign	Het
Nbea	A	C	3: 55,805,357	S2100A	probably benign	Het
Olfr1130	G	T	2: 87,607,973	C195F	probably damaging	Het
Olfr1441	G	A	19: 12,422,986	V226I	probably benign	Het
Olfr328	T	A	11: 58,551,657	Y194F	probably damaging	Het
Olfr449	A	G	6: 42,838,720	T280A	possibly damaging	Het
Oxnad1	C	G	14: 32,091,652	H3Q	possibly damaging	Het
Rab8b	A	T	9: 66,854,666		probably null	Het
Rfc4	T	C	16: 23,114,073	*371W	probably null	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Safb2	A	G	17: 56,571,289	S24P	probably benign	Het
Sele	G	A	1: 164,049,415	V87I	probably benign	Het
Slc8b1	T	A	5: 120,521,126	W212R	probably damaging	Het
Zfp758	A	T	17: 22,375,094	D155V	possibly damaging	Het

Other mutations in Vmn1r88

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01828:Vmn1r88	APN	7	13177735	missense	probably damaging	1.00
IGL01879:Vmn1r88	APN	7	13178302	missense	probably benign	0.12
IGL02028:Vmn1r88	APN	7	13177792	missense	probably benign
IGL02586:Vmn1r88	APN	7	13177808	nonsense	probably null
IGL03176:Vmn1r88	APN	7	13177852	missense	probably damaging	1.00
PIT4466001:Vmn1r88	UTSW	7	13178476	missense	possibly damaging	0.83
R1163:Vmn1r88	UTSW	7	13178133	missense	probably benign
R1478:Vmn1r88	UTSW	7	13177951	missense	probably damaging	1.00
R2376:Vmn1r88	UTSW	7	13177858	missense	probably damaging	0.99
R3624:Vmn1r88	UTSW	7	13177863	missense	probably benign	0.08
R4543:Vmn1r88	UTSW	7	13177980	missense	possibly damaging	0.52
R4593:Vmn1r88	UTSW	7	13177842	missense	probably damaging	0.96
R4721:Vmn1r88	UTSW	7	13178524	nonsense	probably null
R5927:Vmn1r88	UTSW	7	13178513	missense	probably benign	0.12
R6535:Vmn1r88	UTSW	7	13178185	missense	probably benign	0.03
R6598:Vmn1r88	UTSW	7	13178223	missense	probably damaging	1.00
R6857:Vmn1r88	UTSW	7	13178331	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TTGGTGTCATAGGGAACTCATC -3'
(R):5'- TGTGAAAATCCACGGCCAAC -3'

Sequencing Primer
(F):5'- AGATTCAGTTTTTATGCACCTGAC -3'
(R):5'- ACGAGAGTCATATTGGTTTTGGCTAC -3'

Posted On

2018-05-04