Incidental Mutation 'R6411:Vmn1r88'
ID514598
Institutional Source Beutler Lab
Gene Symbol Vmn1r88
Ensembl Gene ENSMUSG00000095902
Gene Namevomeronasal 1 receptor, 88
Synonyms
MMRRC Submission 044384-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6411 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location13177719-13178669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13178043 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 109 (I109F)
Ref Sequence ENSEMBL: ENSMUSP00000128946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171783]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122190
Predicted Effect probably damaging
Transcript: ENSMUST00000171783
AA Change: I109F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128946
Gene: ENSMUSG00000095902
AA Change: I109F

DomainStartEndE-ValueType
Pfam:TAS2R 1 306 2e-14 PFAM
Pfam:V1R 35 301 1.4e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Capn7 A G 14: 31,340,096 E55G probably benign Het
Carmil2 G T 8: 105,697,026 D1211Y probably damaging Het
Carns1 G T 19: 4,166,464 A573E probably damaging Het
Dennd4a A G 9: 64,871,899 R555G probably benign Het
Guf1 T C 5: 69,560,511 I204T possibly damaging Het
Hgsnat C T 8: 25,946,275 V584M possibly damaging Het
Izumo2 A T 7: 44,719,760 Q186L probably benign Het
Lmtk2 A T 5: 144,174,586 Q708L probably damaging Het
Mitf T C 6: 98,010,472 probably null Het
Myo9b T A 8: 71,322,955 Y340* probably null Het
Naip5 A G 13: 100,223,405 I441T probably benign Het
Nbea A C 3: 55,805,357 S2100A probably benign Het
Olfr1130 G T 2: 87,607,973 C195F probably damaging Het
Olfr1441 G A 19: 12,422,986 V226I probably benign Het
Olfr328 T A 11: 58,551,657 Y194F probably damaging Het
Olfr449 A G 6: 42,838,720 T280A possibly damaging Het
Oxnad1 C G 14: 32,091,652 H3Q possibly damaging Het
Rab8b A T 9: 66,854,666 probably null Het
Rfc4 T C 16: 23,114,073 *371W probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Safb2 A G 17: 56,571,289 S24P probably benign Het
Sele G A 1: 164,049,415 V87I probably benign Het
Slc8b1 T A 5: 120,521,126 W212R probably damaging Het
Zfp758 A T 17: 22,375,094 D155V possibly damaging Het
Other mutations in Vmn1r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01828:Vmn1r88 APN 7 13177735 missense probably damaging 1.00
IGL01879:Vmn1r88 APN 7 13178302 missense probably benign 0.12
IGL02028:Vmn1r88 APN 7 13177792 missense probably benign
IGL02586:Vmn1r88 APN 7 13177808 nonsense probably null
IGL03176:Vmn1r88 APN 7 13177852 missense probably damaging 1.00
PIT4466001:Vmn1r88 UTSW 7 13178476 missense possibly damaging 0.83
R1163:Vmn1r88 UTSW 7 13178133 missense probably benign
R1478:Vmn1r88 UTSW 7 13177951 missense probably damaging 1.00
R2376:Vmn1r88 UTSW 7 13177858 missense probably damaging 0.99
R3624:Vmn1r88 UTSW 7 13177863 missense probably benign 0.08
R4543:Vmn1r88 UTSW 7 13177980 missense possibly damaging 0.52
R4593:Vmn1r88 UTSW 7 13177842 missense probably damaging 0.96
R4721:Vmn1r88 UTSW 7 13178524 nonsense probably null
R5927:Vmn1r88 UTSW 7 13178513 missense probably benign 0.12
R6535:Vmn1r88 UTSW 7 13178185 missense probably benign 0.03
R6598:Vmn1r88 UTSW 7 13178223 missense probably damaging 1.00
R6857:Vmn1r88 UTSW 7 13178331 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTGGTGTCATAGGGAACTCATC -3'
(R):5'- TGTGAAAATCCACGGCCAAC -3'

Sequencing Primer
(F):5'- AGATTCAGTTTTTATGCACCTGAC -3'
(R):5'- ACGAGAGTCATATTGGTTTTGGCTAC -3'
Posted On2018-05-04