Incidental Mutation 'R6411:Capn7'
ID514607
Institutional Source Beutler Lab
Gene Symbol Capn7
Ensembl Gene ENSMUSG00000021893
Gene Namecalpain 7
SynonymsPalBH
MMRRC Submission 044384-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R6411 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location31336638-31371986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31340096 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 55 (E55G)
Ref Sequence ENSEMBL: ENSMUSP00000119214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022451] [ENSMUST00000143472] [ENSMUST00000152182]
Predicted Effect probably benign
Transcript: ENSMUST00000022451
AA Change: E55G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022451
Gene: ENSMUSG00000021893
AA Change: E55G

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 547 1.08e-91 SMART
Blast:CysPc 550 620 4e-39 BLAST
calpain_III 686 810 2.78e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143472
AA Change: E55G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000118596
Gene: ENSMUSG00000021893
AA Change: E55G

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152182
AA Change: E55G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000119214
Gene: ENSMUSG00000021893
AA Change: E55G

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226148
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The function of the protein encoded by this gene is not known. An orthologue has been found in mouse but it seems to diverge from other family members. The mouse orthologue is thought to be calcium independent with protease activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene frequently die before weaning. Survivors display reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Carmil2 G T 8: 105,697,026 D1211Y probably damaging Het
Carns1 G T 19: 4,166,464 A573E probably damaging Het
Dennd4a A G 9: 64,871,899 R555G probably benign Het
Guf1 T C 5: 69,560,511 I204T possibly damaging Het
Hgsnat C T 8: 25,946,275 V584M possibly damaging Het
Izumo2 A T 7: 44,719,760 Q186L probably benign Het
Lmtk2 A T 5: 144,174,586 Q708L probably damaging Het
Mitf T C 6: 98,010,472 probably null Het
Myo9b T A 8: 71,322,955 Y340* probably null Het
Naip5 A G 13: 100,223,405 I441T probably benign Het
Nbea A C 3: 55,805,357 S2100A probably benign Het
Olfr1130 G T 2: 87,607,973 C195F probably damaging Het
Olfr1441 G A 19: 12,422,986 V226I probably benign Het
Olfr328 T A 11: 58,551,657 Y194F probably damaging Het
Olfr449 A G 6: 42,838,720 T280A possibly damaging Het
Oxnad1 C G 14: 32,091,652 H3Q possibly damaging Het
Rab8b A T 9: 66,854,666 probably null Het
Rfc4 T C 16: 23,114,073 *371W probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Safb2 A G 17: 56,571,289 S24P probably benign Het
Sele G A 1: 164,049,415 V87I probably benign Het
Slc8b1 T A 5: 120,521,126 W212R probably damaging Het
Vmn1r88 A T 7: 13,178,043 I109F probably damaging Het
Zfp758 A T 17: 22,375,094 D155V possibly damaging Het
Other mutations in Capn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Capn7 APN 14 31363578 missense probably benign 0.41
IGL01481:Capn7 APN 14 31355339 missense probably damaging 1.00
IGL03231:Capn7 APN 14 31355290 missense probably damaging 1.00
R0018:Capn7 UTSW 14 31354112 nonsense probably null
R0018:Capn7 UTSW 14 31354112 nonsense probably null
R0060:Capn7 UTSW 14 31365604 splice site probably benign
R0060:Capn7 UTSW 14 31365604 splice site probably benign
R0077:Capn7 UTSW 14 31368115 missense probably benign 0.10
R0195:Capn7 UTSW 14 31365581 missense probably damaging 1.00
R0316:Capn7 UTSW 14 31347809 missense probably benign 0.00
R0815:Capn7 UTSW 14 31369757 missense possibly damaging 0.85
R0863:Capn7 UTSW 14 31369757 missense possibly damaging 0.85
R1697:Capn7 UTSW 14 31360160 missense probably damaging 1.00
R1954:Capn7 UTSW 14 31360150 missense probably damaging 1.00
R2096:Capn7 UTSW 14 31349887 critical splice donor site probably null
R3121:Capn7 UTSW 14 31359210 missense probably damaging 1.00
R3122:Capn7 UTSW 14 31359210 missense probably damaging 1.00
R4409:Capn7 UTSW 14 31355339 missense probably damaging 1.00
R4676:Capn7 UTSW 14 31359259 missense possibly damaging 0.72
R4799:Capn7 UTSW 14 31360557 missense probably benign 0.01
R5023:Capn7 UTSW 14 31352426 missense probably damaging 0.99
R5129:Capn7 UTSW 14 31344511 missense probably damaging 0.99
R5460:Capn7 UTSW 14 31368203 critical splice donor site probably null
R5608:Capn7 UTSW 14 31370707 missense probably damaging 1.00
R5665:Capn7 UTSW 14 31369802 missense probably benign 0.00
R5786:Capn7 UTSW 14 31360145 missense probably damaging 1.00
R6186:Capn7 UTSW 14 31370918 missense probably damaging 1.00
R6190:Capn7 UTSW 14 31363603 missense probably benign 0.10
R6514:Capn7 UTSW 14 31344554 missense probably benign 0.00
R6838:Capn7 UTSW 14 31354173 missense possibly damaging 0.95
R7041:Capn7 UTSW 14 31336685 unclassified probably benign
R7047:Capn7 UTSW 14 31336685 unclassified probably benign
R7124:Capn7 UTSW 14 31336685 unclassified probably benign
R7224:Capn7 UTSW 14 31370721 nonsense probably null
R7417:Capn7 UTSW 14 31370706 missense probably damaging 1.00
R7419:Capn7 UTSW 14 31349822 missense probably benign 0.02
R7544:Capn7 UTSW 14 31340050 missense probably damaging 1.00
R7699:Capn7 UTSW 14 31352444 missense probably benign 0.00
R7700:Capn7 UTSW 14 31352444 missense probably benign 0.00
R7775:Capn7 UTSW 14 31352410 missense probably benign 0.00
R7824:Capn7 UTSW 14 31352410 missense probably benign 0.00
R7908:Capn7 UTSW 14 31366245 critical splice donor site probably null
R8057:Capn7 UTSW 14 31370979 missense probably benign 0.27
R8176:Capn7 UTSW 14 31347772 missense probably benign 0.03
R8270:Capn7 UTSW 14 31358679 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCACGGCTACTCTGAAGAAGTG -3'
(R):5'- AGCATCTACTATCTCTGAAGCTAGAG -3'

Sequencing Primer
(F):5'- GAAGTGTTTAATAACTGGGTTCTCAG -3'
(R):5'- TCTCTGAAGCTAGAGAAAACTAACTC -3'
Posted On2018-05-04