Incidental Mutation 'R6411:Carns1'
ID514612
Institutional Source Beutler Lab
Gene Symbol Carns1
Ensembl Gene ENSMUSG00000075289
Gene Namecarnosine synthase 1
SynonymsAtpgd1
MMRRC Submission 044384-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6411 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4164324-4175479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4166464 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 573 (A573E)
Ref Sequence ENSEMBL: ENSMUSP00000131624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025749] [ENSMUST00000118483] [ENSMUST00000127605] [ENSMUST00000130469] [ENSMUST00000137431] [ENSMUST00000167055]
Predicted Effect probably benign
Transcript: ENSMUST00000025749
SMART Domains Protein: ENSMUSP00000025749
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 391 2.6e-26 SMART
low complexity region 406 421 N/A INTRINSIC
low complexity region 428 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118483
SMART Domains Protein: ENSMUSP00000112512
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 384 1.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125057
Predicted Effect probably benign
Transcript: ENSMUST00000127605
SMART Domains Protein: ENSMUSP00000123376
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 304 1.6e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130469
SMART Domains Protein: ENSMUSP00000117446
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase 67 153 2.7e-14 PFAM
Pfam:Pkinase_Tyr 67 153 9.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135911
Predicted Effect probably benign
Transcript: ENSMUST00000137431
SMART Domains Protein: ENSMUSP00000116744
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase_Tyr 67 277 4.6e-31 PFAM
Pfam:Pkinase 67 278 2.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155303
Predicted Effect probably damaging
Transcript: ENSMUST00000167055
AA Change: A573E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131624
Gene: ENSMUSG00000075289
AA Change: A573E

DomainStartEndE-ValueType
low complexity region 206 217 N/A INTRINSIC
low complexity region 312 328 N/A INTRINSIC
low complexity region 332 348 N/A INTRINSIC
low complexity region 399 410 N/A INTRINSIC
low complexity region 414 433 N/A INTRINSIC
low complexity region 490 496 N/A INTRINSIC
Pfam:ATP-grasp_4 620 819 4.1e-46 PFAM
low complexity region 862 875 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181211
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CARNS1 (EC 6.3.2.11), a member of the ATP-grasp family of ATPases, catalyzes the formation of carnosine (beta-alanyl-L-histidine) and homocarnosine (gamma-aminobutyryl-L-histidine), which are found mainly in skeletal muscle and the central nervous system, respectively (Drozak et al., 2010 [PubMed 20097752]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Capn7 A G 14: 31,340,096 E55G probably benign Het
Carmil2 G T 8: 105,697,026 D1211Y probably damaging Het
Dennd4a A G 9: 64,871,899 R555G probably benign Het
Guf1 T C 5: 69,560,511 I204T possibly damaging Het
Hgsnat C T 8: 25,946,275 V584M possibly damaging Het
Izumo2 A T 7: 44,719,760 Q186L probably benign Het
Lmtk2 A T 5: 144,174,586 Q708L probably damaging Het
Mitf T C 6: 98,010,472 probably null Het
Myo9b T A 8: 71,322,955 Y340* probably null Het
Naip5 A G 13: 100,223,405 I441T probably benign Het
Nbea A C 3: 55,805,357 S2100A probably benign Het
Olfr1130 G T 2: 87,607,973 C195F probably damaging Het
Olfr1441 G A 19: 12,422,986 V226I probably benign Het
Olfr328 T A 11: 58,551,657 Y194F probably damaging Het
Olfr449 A G 6: 42,838,720 T280A possibly damaging Het
Oxnad1 C G 14: 32,091,652 H3Q possibly damaging Het
Rab8b A T 9: 66,854,666 probably null Het
Rfc4 T C 16: 23,114,073 *371W probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Safb2 A G 17: 56,571,289 S24P probably benign Het
Sele G A 1: 164,049,415 V87I probably benign Het
Slc8b1 T A 5: 120,521,126 W212R probably damaging Het
Vmn1r88 A T 7: 13,178,043 I109F probably damaging Het
Zfp758 A T 17: 22,375,094 D155V possibly damaging Het
Other mutations in Carns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Carns1 APN 19 4166499 splice site probably null
IGL02246:Carns1 APN 19 4166432 missense possibly damaging 0.87
IGL02658:Carns1 APN 19 4173084 missense probably benign 0.01
IGL02800:Carns1 APN 19 4166570 splice site probably benign
R1750:Carns1 UTSW 19 4173157 missense possibly damaging 0.63
R1902:Carns1 UTSW 19 4166338 missense probably damaging 1.00
R1935:Carns1 UTSW 19 4165474 missense probably damaging 1.00
R2434:Carns1 UTSW 19 4165449 missense probably damaging 1.00
R2437:Carns1 UTSW 19 4165783 missense possibly damaging 0.69
R3772:Carns1 UTSW 19 4170916 splice site probably benign
R4091:Carns1 UTSW 19 4171683 missense probably damaging 0.96
R4518:Carns1 UTSW 19 4170070 missense probably benign 0.05
R4668:Carns1 UTSW 19 4165476 nonsense probably null
R4737:Carns1 UTSW 19 4170928 intron probably benign
R4751:Carns1 UTSW 19 4166418 missense probably damaging 1.00
R5384:Carns1 UTSW 19 4171901 critical splice acceptor site probably null
R6077:Carns1 UTSW 19 4170876 missense probably benign 0.01
R6373:Carns1 UTSW 19 4166516 missense probably benign 0.41
R6470:Carns1 UTSW 19 4171783 missense possibly damaging 0.85
R6486:Carns1 UTSW 19 4169980 missense probably benign 0.04
R6915:Carns1 UTSW 19 4169913 missense probably benign 0.34
R6981:Carns1 UTSW 19 4170082 missense probably benign 0.00
R7936:Carns1 UTSW 19 4166153 missense probably benign
R8025:Carns1 UTSW 19 4166506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCCAATGGGCAACAGG -3'
(R):5'- GAAACCCATCCTGTATCGTCC -3'

Sequencing Primer
(F):5'- CTGGCACCGCAACAGATGTAG -3'
(R):5'- TGTATCGTCCATGACCCAAC -3'
Posted On2018-05-04