Incidental Mutation 'R6411:Olfr1441'
ID514613
Institutional Source Beutler Lab
Gene Symbol Olfr1441
Ensembl Gene ENSMUSG00000050815
Gene Nameolfactory receptor 1441
SynonymsGA_x6K02T2RE5P-2753221-2754177, MOR215-2
MMRRC Submission 044384-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6411 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location12417433-12423569 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12422986 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 226 (V226I)
Ref Sequence ENSEMBL: ENSMUSP00000150739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059033] [ENSMUST00000168148] [ENSMUST00000214153] [ENSMUST00000216506]
Predicted Effect probably benign
Transcript: ENSMUST00000059033
AA Change: V226I

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000061963
Gene: ENSMUSG00000050815
AA Change: V226I

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.7e-52 PFAM
Pfam:7tm_1 42 313 5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168148
SMART Domains Protein: ENSMUSP00000126346
Gene: ENSMUSG00000040065

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
MACPF 144 343 6.26e-33 SMART
transmembrane domain 643 665 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214153
AA Change: V226I

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000216506
AA Change: V226I

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Capn7 A G 14: 31,340,096 E55G probably benign Het
Carmil2 G T 8: 105,697,026 D1211Y probably damaging Het
Carns1 G T 19: 4,166,464 A573E probably damaging Het
Dennd4a A G 9: 64,871,899 R555G probably benign Het
Guf1 T C 5: 69,560,511 I204T possibly damaging Het
Hgsnat C T 8: 25,946,275 V584M possibly damaging Het
Izumo2 A T 7: 44,719,760 Q186L probably benign Het
Lmtk2 A T 5: 144,174,586 Q708L probably damaging Het
Mitf T C 6: 98,010,472 probably null Het
Myo9b T A 8: 71,322,955 Y340* probably null Het
Naip5 A G 13: 100,223,405 I441T probably benign Het
Nbea A C 3: 55,805,357 S2100A probably benign Het
Olfr1130 G T 2: 87,607,973 C195F probably damaging Het
Olfr328 T A 11: 58,551,657 Y194F probably damaging Het
Olfr449 A G 6: 42,838,720 T280A possibly damaging Het
Oxnad1 C G 14: 32,091,652 H3Q possibly damaging Het
Rab8b A T 9: 66,854,666 probably null Het
Rfc4 T C 16: 23,114,073 *371W probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Safb2 A G 17: 56,571,289 S24P probably benign Het
Sele G A 1: 164,049,415 V87I probably benign Het
Slc8b1 T A 5: 120,521,126 W212R probably damaging Het
Vmn1r88 A T 7: 13,178,043 I109F probably damaging Het
Zfp758 A T 17: 22,375,094 D155V possibly damaging Het
Other mutations in Olfr1441
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Olfr1441 APN 19 12422801 missense possibly damaging 0.91
IGL01653:Olfr1441 APN 19 12422372 missense probably benign
IGL01667:Olfr1441 APN 19 12422756 missense probably benign
IGL01903:Olfr1441 APN 19 12422683 missense probably benign 0.00
IGL02547:Olfr1441 APN 19 12422311 start codon destroyed probably benign 0.38
IGL02571:Olfr1441 APN 19 12422886 missense possibly damaging 0.79
IGL03310:Olfr1441 APN 19 12422927 missense probably benign
R0539:Olfr1441 UTSW 19 12422809 missense probably damaging 0.97
R0918:Olfr1441 UTSW 19 12423235 missense probably benign 0.25
R1463:Olfr1441 UTSW 19 12422888 missense probably benign 0.41
R4301:Olfr1441 UTSW 19 12422717 missense probably damaging 0.98
R4785:Olfr1441 UTSW 19 12422977 missense probably damaging 0.99
R5513:Olfr1441 UTSW 19 12422683 missense probably benign 0.00
R6188:Olfr1441 UTSW 19 12422610 missense probably benign 0.01
R6625:Olfr1441 UTSW 19 12422841 missense probably damaging 1.00
R6944:Olfr1441 UTSW 19 12423264 missense probably benign
R7425:Olfr1441 UTSW 19 12422840 missense probably damaging 1.00
R7465:Olfr1441 UTSW 19 12423145 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGGCTTGATCCAAACTAG -3'
(R):5'- GGGTTCAACATGGGAATCACTG -3'

Sequencing Primer
(F):5'- TGATCCAAACTAGCTCCATATTCCG -3'
(R):5'- TGGGAATCACTGCACCATAG -3'
Posted On2018-05-04