Incidental Mutation 'R6412:Ret'
ID 514625
Institutional Source Beutler Lab
Gene Symbol Ret
Ensembl Gene ENSMUSG00000030110
Gene Name ret proto-oncogene
Synonyms RET9, c-Ret, RET51
MMRRC Submission 044385-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.825) question?
Stock # R6412 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 118128706-118174679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 118161245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 77 (R77H)
Ref Sequence ENSEMBL: ENSMUSP00000086169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032201] [ENSMUST00000088790]
AlphaFold P35546
Predicted Effect probably benign
Transcript: ENSMUST00000032201
AA Change: R77H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032201
Gene: ENSMUSG00000030110
AA Change: R77H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088790
AA Change: R77H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000086169
Gene: ENSMUSG00000030110
AA Change: R77H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some point mutations or knock-out alleles exhibit premature lethality, defects in neurogenesis, and abnormal kidney, ureter, ovary, muscle, and intestine morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,807,116 (GRCm39) I480V probably benign Het
BC025920 T C 10: 81,445,195 (GRCm39) V106A probably benign Het
Bhlhe23 A G 2: 180,417,963 (GRCm39) F192L possibly damaging Het
Cftr C T 6: 18,285,603 (GRCm39) T1137I probably damaging Het
Chst8 T C 7: 34,375,504 (GRCm39) M112V probably benign Het
Cilk1 T C 9: 78,047,258 (GRCm39) S53P probably damaging Het
Fbxw26 T A 9: 109,561,715 (GRCm39) M160L probably damaging Het
Gm3264 A G 14: 16,058,238 (GRCm39) K81R probably damaging Het
Htr3b T C 9: 48,857,819 (GRCm39) N141S possibly damaging Het
Itgb2l T C 16: 96,228,929 (GRCm39) S425G probably benign Het
Kbtbd12 T C 6: 88,595,638 (GRCm39) E64G probably damaging Het
Lct T C 1: 128,255,455 (GRCm39) T196A probably benign Het
Luzp2 T C 7: 54,707,794 (GRCm39) S61P probably damaging Het
Or4b1b G T 2: 90,112,202 (GRCm39) A239D probably damaging Het
Or5l14 A T 2: 87,792,693 (GRCm39) L181Q probably damaging Het
Rag1 A G 2: 101,472,865 (GRCm39) V759A probably damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Sbno1 T C 5: 124,530,777 (GRCm39) T840A probably damaging Het
Skic2 A G 17: 35,059,276 (GRCm39) V1057A possibly damaging Het
Spocd1 C T 4: 129,847,365 (GRCm39) S518L probably benign Het
Thbs2 A C 17: 14,897,339 (GRCm39) L723R probably damaging Het
Vmn1r223 G T 13: 23,433,825 (GRCm39) V140F probably benign Het
Vmn2r52 A G 7: 9,904,936 (GRCm39) V301A probably benign Het
Vwf T C 6: 125,656,279 (GRCm39) F2615L probably benign Het
Wdr81 G T 11: 75,341,989 (GRCm39) P1093T probably benign Het
Xdh T C 17: 74,242,902 (GRCm39) E135G probably benign Het
Zfp990 C A 4: 145,264,138 (GRCm39) P379T probably benign Het
Other mutations in Ret
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Ret APN 6 118,152,081 (GRCm39) splice site probably null
IGL02445:Ret APN 6 118,158,860 (GRCm39) missense probably damaging 0.98
IGL02754:Ret APN 6 118,153,213 (GRCm39) missense probably benign 0.03
IGL02828:Ret APN 6 118,153,168 (GRCm39) missense probably benign 0.00
IGL03058:Ret APN 6 118,152,028 (GRCm39) missense probably damaging 1.00
PIT4151001:Ret UTSW 6 118,141,702 (GRCm39) missense probably benign 0.04
R0126:Ret UTSW 6 118,142,956 (GRCm39) splice site probably benign
R0555:Ret UTSW 6 118,155,571 (GRCm39) missense probably damaging 0.96
R1168:Ret UTSW 6 118,150,519 (GRCm39) missense possibly damaging 0.94
R1829:Ret UTSW 6 118,130,912 (GRCm39) missense probably damaging 0.99
R2020:Ret UTSW 6 118,157,343 (GRCm39) missense possibly damaging 0.63
R4082:Ret UTSW 6 118,130,927 (GRCm39) missense possibly damaging 0.81
R4732:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R4733:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R5356:Ret UTSW 6 118,174,079 (GRCm39) missense possibly damaging 0.73
R5401:Ret UTSW 6 118,158,936 (GRCm39) missense probably benign 0.05
R5572:Ret UTSW 6 118,132,392 (GRCm39) missense probably damaging 1.00
R5669:Ret UTSW 6 118,161,204 (GRCm39) missense probably benign
R6058:Ret UTSW 6 118,156,280 (GRCm39) missense probably benign
R6087:Ret UTSW 6 118,153,252 (GRCm39) missense possibly damaging 0.53
R6457:Ret UTSW 6 118,150,582 (GRCm39) missense probably benign 0.01
R6884:Ret UTSW 6 118,132,362 (GRCm39) missense probably damaging 1.00
R7035:Ret UTSW 6 118,140,247 (GRCm39) missense probably damaging 1.00
R7112:Ret UTSW 6 118,174,063 (GRCm39) missense possibly damaging 0.96
R7841:Ret UTSW 6 118,132,321 (GRCm39) missense probably damaging 1.00
R7947:Ret UTSW 6 118,151,305 (GRCm39) missense probably benign 0.32
R8539:Ret UTSW 6 118,152,770 (GRCm39) missense possibly damaging 0.60
R8556:Ret UTSW 6 118,146,149 (GRCm39) missense probably damaging 1.00
R8742:Ret UTSW 6 118,155,484 (GRCm39) missense probably damaging 0.99
R8904:Ret UTSW 6 118,157,174 (GRCm39) splice site probably benign
R9051:Ret UTSW 6 118,142,888 (GRCm39) nonsense probably null
R9323:Ret UTSW 6 118,158,975 (GRCm39) missense probably benign 0.00
R9661:Ret UTSW 6 118,150,437 (GRCm39) missense probably benign
R9674:Ret UTSW 6 118,130,830 (GRCm39) missense probably damaging 1.00
Z1176:Ret UTSW 6 118,140,168 (GRCm39) missense probably damaging 1.00
Z1177:Ret UTSW 6 118,130,851 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GTACCTTACACCCTTGGCCAT -3'
(R):5'- ACCCTCGTGTCTCCTGCAG -3'

Sequencing Primer
(F):5'- ATCCCTGGCCTCAGACTG -3'
(R):5'- GTGTCTCCTGCAGCCCCAC -3'
Posted On 2018-05-04