Mutagenetix > Incidental Mutations

Incidental Mutation 'R6387:Spta1'

514643

Institutional Source

Beutler Lab

Gene Symbol

Spta1

Ensembl Gene

ENSMUSG00000026532

Gene Name

spectrin alpha, erythrocytic 1

Synonyms

erythroid, Spna-1, ihj, Spna1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R6387 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

174172776-174248450 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 174231333 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 1945 (A1945T)

Ref Sequence

ENSEMBL: ENSMUSP00000027817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027817]

Predicted Effect

probably benign
Transcript: ENSMUST00000027817
AA Change: A1945T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: A1945T

Domain	Start	End	E-Value	Type
SPEC	55	153	3.62e-11	SMART
SPEC	159	259	1.84e-26	SMART
SPEC	265	365	1.56e-24	SMART
SPEC	371	471	8.35e-25	SMART
SPEC	477	577	1.19e-29	SMART
SPEC	583	682	2.43e-26	SMART
SPEC	688	788	1.3e-26	SMART
SPEC	794	894	1.66e-28	SMART
SPEC	900	1077	5.03e-19	SMART
SH3	978	1033	2.98e-15	SMART
SPEC	1083	1178	2.57e-16	SMART
SPEC	1184	1284	1.15e-27	SMART
SPEC	1290	1390	7.05e-23	SMART
SPEC	1396	1495	6.04e-22	SMART
SPEC	1501	1602	1.15e-27	SMART
SPEC	1608	1708	5.46e-29	SMART
SPEC	1714	1814	1.08e-32	SMART
SPEC	1820	1921	2.17e-23	SMART
SPEC	1927	2028	2.19e-19	SMART
SPEC	2042	2142	3.87e-11	SMART
SPEC	2156	2253	9.77e-8	SMART
low complexity region	2307	2318	N/A	INTRINSIC
efhand_Ca_insen	2346	2414	2.37e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156092

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	C	5: 109,737,015	K326E	possibly damaging	Het
Acot1	A	G	12: 84,009,853	D115G	probably benign	Het
Adm	T	C	7: 110,628,295	I6T	possibly damaging	Het
Ahi1	A	G	10: 20,969,043	Y349C	probably damaging	Het
Aldh1a1	A	G	19: 20,617,959	E84G	probably damaging	Het
Ankrd31	A	G	13: 96,830,573	D520G	probably damaging	Het
Ano4	A	T	10: 88,971,405	Y736*	probably null	Het
Atp6v1a	A	G	16: 44,087,443	F612S	possibly damaging	Het
Calcb	G	A	7: 114,719,790	V17I	possibly damaging	Het
Cfap70	C	T	14: 20,448,575	V15M	probably damaging	Het
Chad	C	T	11: 94,567,837	H271Y	possibly damaging	Het
Csgalnact1	C	T	8: 68,358,713	G435D	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Eprs	T	A	1: 185,387,084	M487K	possibly damaging	Het
Fat4	A	G	3: 38,983,785	E3862G	probably damaging	Het
Gdf10	T	A	14: 33,924,004	S37T	probably benign	Het
Hhatl	T	A	9: 121,790,401	H39L	probably benign	Het
Icam4	A	C	9: 21,030,209	S215R	possibly damaging	Het
Ighv1-18	T	C	12: 114,682,660	E108G	probably damaging	Het
Iqcd	T	C	5: 120,606,855	I416T	probably benign	Het
Marf1	T	A	16: 14,141,640	*577L	probably null	Het
Mark2	A	G	19: 7,285,902	F167L	probably damaging	Het
Mpdz	T	C	4: 81,381,709	T351A	possibly damaging	Het
Mrps27	A	G	13: 99,400,317	I113V	possibly damaging	Het
Numbl	C	T	7: 27,276,690	T265I	probably damaging	Het
Obsl1	C	T	1: 75,491,362	A1296T	probably benign	Het
Olfr979	A	G	9: 40,000,852	I125T	probably damaging	Het
Pcdhb21	A	G	18: 37,515,332	I505V	probably benign	Het
Pfas	A	G	11: 69,000,465	F269L	probably damaging	Het
Prkdc	G	A	16: 15,698,815	V1018I	probably benign	Het
Prl4a1	T	A	13: 28,018,499	V19E	possibly damaging	Het
Ptpn22	A	G	3: 103,885,386	D327G	probably benign	Het
Smad3	G	T	9: 63,654,765	D310E	probably benign	Het
Sparcl1	T	A	5: 104,085,060	D625V	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Sympk	T	C	7: 19,052,498	Y1009H	possibly damaging	Het
Trio	A	G	15: 27,752,739	F1026L	probably damaging	Het
Uhrf1bp1l	C	T	10: 89,803,057	Q442*	probably null	Het
Unc5d	T	A	8: 28,875,526	K144*	probably null	Het
Unk	A	G	11: 116,054,940	N479S	possibly damaging	Het
Zfp710	T	C	7: 80,086,027	I514T	probably damaging	Het
Zfp993	A	G	4: 146,657,518	T100A	probably damaging	Het

Other mutations in Spta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Spta1	APN	1	174208390	nonsense	probably null
IGL01095:Spta1	APN	1	174213485	missense	probably benign	0.02
IGL01144:Spta1	APN	1	174187263	missense	probably benign	0.05
IGL01455:Spta1	APN	1	174203311	missense	possibly damaging	0.78
IGL01541:Spta1	APN	1	174217159	missense	probably benign	0.03
IGL01613:Spta1	APN	1	174208394	missense	probably damaging	1.00
IGL01804:Spta1	APN	1	174244180	missense	probably benign	0.42
IGL01859:Spta1	APN	1	174174372	missense	probably damaging	1.00
IGL01898:Spta1	APN	1	174213862	missense	probably benign	0.00
IGL02106:Spta1	APN	1	174203294	missense	probably benign	0.02
IGL02166:Spta1	APN	1	174190231	missense	probably damaging	1.00
IGL02224:Spta1	APN	1	174217689	critical splice donor site	probably benign
IGL02318:Spta1	APN	1	174174463	missense	possibly damaging	0.51
IGL02392:Spta1	APN	1	174218814	missense	probably damaging	0.96
IGL02852:Spta1	APN	1	174244110	missense	probably benign	0.24
IGL02861:Spta1	APN	1	174211598	missense	probably damaging	1.00
IGL02982:Spta1	APN	1	174187288	missense	probably benign	0.00
IGL03057:Spta1	APN	1	174181058	missense	probably benign	0.19
IGL03215:Spta1	APN	1	174218743	missense	probably damaging	1.00
IGL03263:Spta1	APN	1	174213918	missense	probably damaging	0.99
IGL03272:Spta1	APN	1	174214144	missense	probably benign	0.08
Deflection	UTSW	1	174241087	missense	probably damaging	1.00
Goldfoil	UTSW	1	174218512	missense	probably damaging	1.00
H8786:Spta1	UTSW	1	174179839	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174205273	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174205273	missense	probably damaging	0.98
R0010:Spta1	UTSW	1	174217943	missense	probably benign	0.03
R0010:Spta1	UTSW	1	174217943	missense	probably benign	0.03
R0078:Spta1	UTSW	1	174207032	splice site	probably benign
R0172:Spta1	UTSW	1	174230786	missense	probably damaging	1.00
R0206:Spta1	UTSW	1	174192960	missense	probably damaging	1.00
R0208:Spta1	UTSW	1	174192960	missense	probably damaging	1.00
R0276:Spta1	UTSW	1	174217894	missense	probably damaging	1.00
R0288:Spta1	UTSW	1	174243179	missense	probably damaging	0.99
R0323:Spta1	UTSW	1	174218451	missense	probably damaging	1.00
R0454:Spta1	UTSW	1	174213942	missense	probably damaging	1.00
R0508:Spta1	UTSW	1	174224457	missense	probably damaging	1.00
R0698:Spta1	UTSW	1	174181104	missense	probably damaging	1.00
R0751:Spta1	UTSW	1	174184690	missense	probably damaging	1.00
R0925:Spta1	UTSW	1	174174426	missense	possibly damaging	0.85
R0941:Spta1	UTSW	1	174245205	unclassified	probably benign
R1131:Spta1	UTSW	1	174185647	missense	probably damaging	1.00
R1171:Spta1	UTSW	1	174211614	nonsense	probably null
R1184:Spta1	UTSW	1	174184690	missense	probably damaging	1.00
R1401:Spta1	UTSW	1	174222684	missense	probably damaging	1.00
R1489:Spta1	UTSW	1	174231325	missense	probably damaging	0.97
R1532:Spta1	UTSW	1	174247353	missense	probably damaging	0.99
R1551:Spta1	UTSW	1	174240166	missense	possibly damaging	0.94
R1555:Spta1	UTSW	1	174178749	missense	probably damaging	0.99
R1566:Spta1	UTSW	1	174184706	missense	probably benign	0.00
R1586:Spta1	UTSW	1	174213495	missense	probably benign	0.00
R1676:Spta1	UTSW	1	174179839	missense	probably damaging	0.98
R1711:Spta1	UTSW	1	174241042	missense	probably damaging	1.00
R1795:Spta1	UTSW	1	174245730	missense	probably damaging	1.00
R1823:Spta1	UTSW	1	174246549	missense	probably benign	0.05
R1842:Spta1	UTSW	1	174195947	missense	probably benign	0.00
R1867:Spta1	UTSW	1	174219839	missense	probably benign	0.33
R1970:Spta1	UTSW	1	174240367	missense	possibly damaging	0.88
R2042:Spta1	UTSW	1	174211647	missense	probably benign	0.20
R2095:Spta1	UTSW	1	174244198	missense	possibly damaging	0.75
R2125:Spta1	UTSW	1	174208344	missense	possibly damaging	0.80
R2145:Spta1	UTSW	1	174212614	missense	probably benign	0.00
R2158:Spta1	UTSW	1	174229258	missense	probably benign	0.41
R2187:Spta1	UTSW	1	174192966	missense	probably damaging	1.00
R2250:Spta1	UTSW	1	174244114	missense	probably damaging	1.00
R2258:Spta1	UTSW	1	174174341	missense	possibly damaging	0.76
R2319:Spta1	UTSW	1	174178656	critical splice acceptor site	probably null
R3782:Spta1	UTSW	1	174208314	missense	probably damaging	1.00
R4058:Spta1	UTSW	1	174241137	missense	probably damaging	1.00
R4080:Spta1	UTSW	1	174214066	missense	probably benign	0.00
R4081:Spta1	UTSW	1	174214066	missense	probably benign	0.00
R4082:Spta1	UTSW	1	174214066	missense	probably benign	0.00
R4108:Spta1	UTSW	1	174174556	missense	probably benign	0.01
R4115:Spta1	UTSW	1	174240357	missense	probably damaging	1.00
R4303:Spta1	UTSW	1	174179852	missense	probably damaging	1.00
R4419:Spta1	UTSW	1	174247424	nonsense	probably null
R4525:Spta1	UTSW	1	174207110	missense	probably null	1.00
R4614:Spta1	UTSW	1	174192977	missense	probably damaging	1.00
R4673:Spta1	UTSW	1	174191062	splice site	probably null
R4782:Spta1	UTSW	1	174230666	missense	probably benign	0.01
R4825:Spta1	UTSW	1	174244042	critical splice acceptor site	probably null
R4829:Spta1	UTSW	1	174237927	missense	probably benign	0.01
R4873:Spta1	UTSW	1	174175830	missense	probably damaging	1.00
R4875:Spta1	UTSW	1	174175830	missense	probably damaging	1.00
R4898:Spta1	UTSW	1	174237834	missense	possibly damaging	0.94
R4910:Spta1	UTSW	1	174217863	splice site	probably null
R4911:Spta1	UTSW	1	174185647	missense	probably damaging	1.00
R4928:Spta1	UTSW	1	174191056	missense	probably benign	0.15
R4959:Spta1	UTSW	1	174246608	missense	probably damaging	0.97
R5009:Spta1	UTSW	1	174240223	missense	possibly damaging	0.62
R5149:Spta1	UTSW	1	174247434	missense	probably damaging	0.99
R5293:Spta1	UTSW	1	174195985	missense	probably damaging	0.99
R5421:Spta1	UTSW	1	174215529	missense	probably damaging	0.99
R5457:Spta1	UTSW	1	174217193	missense	probably damaging	1.00
R5590:Spta1	UTSW	1	174175770	missense	possibly damaging	0.73
R5606:Spta1	UTSW	1	174219902	missense	probably damaging	1.00
R5736:Spta1	UTSW	1	174214255	critical splice donor site	probably null
R5834:Spta1	UTSW	1	174184797	splice site	probably null
R5845:Spta1	UTSW	1	174241096	missense	probably damaging	0.97
R5987:Spta1	UTSW	1	174223328	missense	probably damaging	1.00
R6102:Spta1	UTSW	1	174224520	missense	probably benign	0.01
R6221:Spta1	UTSW	1	174181776	missense	probably damaging	1.00
R6276:Spta1	UTSW	1	174218512	missense	probably damaging	1.00
R6317:Spta1	UTSW	1	174241087	missense	probably damaging	1.00
R6329:Spta1	UTSW	1	174214177	missense	possibly damaging	0.60
R6352:Spta1	UTSW	1	174211646	missense	possibly damaging	0.94
R6374:Spta1	UTSW	1	174214168	missense	probably damaging	1.00
R6376:Spta1	UTSW	1	174203322	missense	probably benign
R6451:Spta1	UTSW	1	174217201	missense	probably damaging	0.97
R6480:Spta1	UTSW	1	174187148	splice site	probably null
R6533:Spta1	UTSW	1	174244147	missense	probably damaging	1.00
R6585:Spta1	UTSW	1	174178685	missense	probably damaging	1.00
R6695:Spta1	UTSW	1	174244042	critical splice acceptor site	probably null
R6945:Spta1	UTSW	1	174209325	missense	possibly damaging	0.89
R7020:Spta1	UTSW	1	174209352	missense	probably damaging	1.00
R7086:Spta1	UTSW	1	174199484	missense	probably damaging	0.98
R7087:Spta1	UTSW	1	174174510	missense	probably benign
R7151:Spta1	UTSW	1	174197751	missense	probably damaging	1.00
R7193:Spta1	UTSW	1	174184612	missense	probably damaging	1.00
R7199:Spta1	UTSW	1	174223271	missense	possibly damaging	0.61
R7219:Spta1	UTSW	1	174222637	missense	probably damaging	0.96
R7343:Spta1	UTSW	1	174223349	missense	probably damaging	0.99
R7372:Spta1	UTSW	1	174197635	nonsense	probably null
R7472:Spta1	UTSW	1	174246499	missense	probably damaging	1.00
R7516:Spta1	UTSW	1	174197783	missense	probably damaging	1.00
R7627:Spta1	UTSW	1	174205378	missense	probably damaging	1.00
R7770:Spta1	UTSW	1	174195981	nonsense	probably null
R7784:Spta1	UTSW	1	174202451	missense	probably damaging	1.00
R7804:Spta1	UTSW	1	174195905	missense	possibly damaging	0.50
R7854:Spta1	UTSW	1	174218830	critical splice donor site	probably null
R7862:Spta1	UTSW	1	174197785	critical splice donor site	probably null
R7958:Spta1	UTSW	1	174174390	missense	probably benign	0.03
R8015:Spta1	UTSW	1	174240171	missense	probably damaging	1.00
R8076:Spta1	UTSW	1	174187231	missense	probably benign	0.00
R8152:Spta1	UTSW	1	174217944	missense	probably benign	0.03
R8235:Spta1	UTSW	1	174202386	missense	probably damaging	1.00
R8284:Spta1	UTSW	1	174179821	missense	probably benign	0.00
R8298:Spta1	UTSW	1	174247387	missense	probably damaging	1.00
R8312:Spta1	UTSW	1	174240211	missense	probably damaging	1.00
R8495:Spta1	UTSW	1	174215485	missense	probably benign	0.00
R8550:Spta1	UTSW	1	174187208	missense	probably damaging	1.00
RF002:Spta1	UTSW	1	174231360	missense	possibly damaging	0.62
RF018:Spta1	UTSW	1	174209319	missense	probably damaging	1.00
RF020:Spta1	UTSW	1	174213444	missense	probably benign	0.42
RF020:Spta1	UTSW	1	174217903	missense	probably damaging	1.00
T0722:Spta1	UTSW	1	174191066	splice site	probably benign
X0028:Spta1	UTSW	1	174224450	missense	probably damaging	1.00
Z1176:Spta1	UTSW	1	174191051	missense	probably damaging	1.00
Z1176:Spta1	UTSW	1	174240367	missense	probably damaging	0.99
Z1177:Spta1	UTSW	1	174190162	missense	probably benign	0.09
Z1177:Spta1	UTSW	1	174245689	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GCACTTAGCACTCTCAGTCAG -3'
(R):5'- CCACTGAGATATTGCATCAGGTC -3'

Sequencing Primer
(F):5'- CTCAGTCAGTTTTATTTTAAGGGCAG -3'
(R):5'- CCTCTACTATCAAGGAAGGAGGTG -3'

Posted On

2018-05-04