Incidental Mutation 'R6387:4930522L14Rik'
ID514650
Institutional Source Beutler Lab
Gene Symbol 4930522L14Rik
Ensembl Gene ENSMUSG00000072762
Gene NameRIKEN cDNA 4930522L14 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location109735990-109751886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109737015 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 326 (K326E)
Ref Sequence ENSEMBL: ENSMUSP00000108166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100937] [ENSMUST00000112547]
Predicted Effect probably benign
Transcript: ENSMUST00000100937
SMART Domains Protein: ENSMUSP00000098497
Gene: ENSMUSG00000072762

DomainStartEndE-ValueType
KRAB 4 64 5.37e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112547
AA Change: K326E

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108166
Gene: ENSMUSG00000072762
AA Change: K326E

DomainStartEndE-ValueType
KRAB 4 66 7.19e-16 SMART
ZnF_C2H2 103 125 2.75e-3 SMART
ZnF_C2H2 131 153 1.72e-4 SMART
ZnF_C2H2 159 181 7.9e-4 SMART
ZnF_C2H2 187 209 1.04e-3 SMART
ZnF_C2H2 215 237 1.1e-2 SMART
ZnF_C2H2 243 265 3.89e-3 SMART
ZnF_C2H2 271 294 3.69e-4 SMART
ZnF_C2H2 300 322 5.9e-3 SMART
ZnF_C2H2 328 350 1.56e-2 SMART
ZnF_C2H2 356 378 1.18e-2 SMART
ZnF_C2H2 384 406 9.08e-4 SMART
ZnF_C2H2 412 434 1.98e-4 SMART
ZnF_C2H2 440 462 2.61e-4 SMART
ZnF_C2H2 468 491 1.38e-3 SMART
ZnF_C2H2 497 519 3.39e-3 SMART
ZnF_C2H2 525 547 1.4e-4 SMART
ZnF_C2H2 553 576 1.95e-3 SMART
ZnF_C2H2 582 604 5.14e-3 SMART
ZnF_C2H2 610 632 1.67e-2 SMART
ZnF_C2H2 638 660 1.72e-4 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in 4930522L14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02622:4930522L14Rik APN 5 109739235 missense possibly damaging 0.86
R0164:4930522L14Rik UTSW 5 109736847 missense probably damaging 0.96
R0164:4930522L14Rik UTSW 5 109736847 missense probably damaging 0.96
R0432:4930522L14Rik UTSW 5 109736919 missense probably damaging 1.00
R0463:4930522L14Rik UTSW 5 109737060 unclassified probably benign
R0891:4930522L14Rik UTSW 5 109736290 missense possibly damaging 0.47
R1289:4930522L14Rik UTSW 5 109736890 nonsense probably null
R1637:4930522L14Rik UTSW 5 109738992 missense probably benign 0.01
R1764:4930522L14Rik UTSW 5 109736789 missense probably benign 0.22
R1793:4930522L14Rik UTSW 5 109736278 missense probably damaging 1.00
R1860:4930522L14Rik UTSW 5 109736232 missense probably damaging 1.00
R1899:4930522L14Rik UTSW 5 109736798 missense probably benign 0.04
R2135:4930522L14Rik UTSW 5 109737643 missense probably benign 0.00
R2143:4930522L14Rik UTSW 5 109736750 missense probably damaging 1.00
R2877:4930522L14Rik UTSW 5 109738945 splice site probably benign
R3847:4930522L14Rik UTSW 5 109736324 splice site probably null
R4431:4930522L14Rik UTSW 5 109736574 missense possibly damaging 0.47
R4578:4930522L14Rik UTSW 5 109736671 nonsense probably null
R4611:4930522L14Rik UTSW 5 109737393 missense probably benign 0.00
R4776:4930522L14Rik UTSW 5 109736873 missense probably benign 0.22
R4921:4930522L14Rik UTSW 5 109737796 missense probably benign 0.25
R4937:4930522L14Rik UTSW 5 109736201 missense probably benign 0.12
R4952:4930522L14Rik UTSW 5 109739197 critical splice donor site probably null
R4980:4930522L14Rik UTSW 5 109737426 missense probably damaging 1.00
R5079:4930522L14Rik UTSW 5 109737330 missense probably benign
R5088:4930522L14Rik UTSW 5 109736073 missense probably damaging 1.00
R5143:4930522L14Rik UTSW 5 109739198 critical splice donor site probably null
R5183:4930522L14Rik UTSW 5 109739305 missense probably damaging 1.00
R5461:4930522L14Rik UTSW 5 109736777 missense possibly damaging 0.74
R5498:4930522L14Rik UTSW 5 109737547 missense probably benign 0.05
R5576:4930522L14Rik UTSW 5 109737704 missense probably benign 0.00
R6081:4930522L14Rik UTSW 5 109739231 missense probably damaging 1.00
R6509:4930522L14Rik UTSW 5 109737384 nonsense probably null
R6585:4930522L14Rik UTSW 5 109737668 missense probably damaging 1.00
R7309:4930522L14Rik UTSW 5 109736953 missense probably damaging 1.00
R7740:4930522L14Rik UTSW 5 109737504 nonsense probably null
R7877:4930522L14Rik UTSW 5 109736364 missense probably damaging 1.00
R8526:4930522L14Rik UTSW 5 109737789 missense possibly damaging 0.92
R8884:4930522L14Rik UTSW 5 109737488 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGACCACGAAAAGCAAAGGT -3'
(R):5'- CATGGTCAACTTCGAAAACATGAAAGA -3'

Sequencing Primer
(F):5'- GCCACATTGCTTACATTCATAGGG -3'
(R):5'- TTCACACTGGAGAGAAACCTTAC -3'
Posted On2018-05-04