Incidental Mutation 'R6387:Iqcd'
ID514651
Institutional Source Beutler Lab
Gene Symbol Iqcd
Ensembl Gene ENSMUSG00000029601
Gene NameIQ motif containing D
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location120589016-120607118 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120606855 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 416 (I416T)
Ref Sequence ENSEMBL: ENSMUSP00000091955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031599] [ENSMUST00000069259] [ENSMUST00000094391] [ENSMUST00000111884] [ENSMUST00000140554] [ENSMUST00000156356] [ENSMUST00000177800]
Predicted Effect probably benign
Transcript: ENSMUST00000031599
SMART Domains Protein: ENSMUSP00000031599
Gene: ENSMUSG00000029600

DomainStartEndE-ValueType
low complexity region 235 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069259
AA Change: I383T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000069167
Gene: ENSMUSG00000029601
AA Change: I383T

DomainStartEndE-ValueType
coiled coil region 97 137 N/A INTRINSIC
coiled coil region 209 257 N/A INTRINSIC
coiled coil region 298 348 N/A INTRINSIC
IQ 363 385 5.53e-4 SMART
low complexity region 387 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094391
AA Change: I416T

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000091955
Gene: ENSMUSG00000029601
AA Change: I416T

DomainStartEndE-ValueType
coiled coil region 97 137 N/A INTRINSIC
coiled coil region 209 257 N/A INTRINSIC
coiled coil region 331 381 N/A INTRINSIC
IQ 396 418 5.53e-4 SMART
low complexity region 420 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136070
Predicted Effect probably benign
Transcript: ENSMUST00000140554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147596
Predicted Effect probably benign
Transcript: ENSMUST00000156356
SMART Domains Protein: ENSMUSP00000122910
Gene: ENSMUSG00000029600

DomainStartEndE-ValueType
low complexity region 81 91 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177800
SMART Domains Protein: ENSMUSP00000136946
Gene: ENSMUSG00000029600

DomainStartEndE-ValueType
Pfam:RITA 1 253 2.5e-105 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Iqcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Iqcd APN 5 120600489 missense probably benign 0.00
R1420:Iqcd UTSW 5 120600795 missense probably damaging 1.00
R1574:Iqcd UTSW 5 120600235 missense probably damaging 0.98
R1574:Iqcd UTSW 5 120600235 missense probably damaging 0.98
R4038:Iqcd UTSW 5 120602522 missense probably damaging 0.97
R4178:Iqcd UTSW 5 120602411 missense probably damaging 1.00
R4405:Iqcd UTSW 5 120602420 missense probably damaging 1.00
R5326:Iqcd UTSW 5 120602375 missense probably damaging 1.00
R5364:Iqcd UTSW 5 120600267 missense probably damaging 1.00
R5656:Iqcd UTSW 5 120605126 splice site probably null
R5691:Iqcd UTSW 5 120602506 nonsense probably null
R5711:Iqcd UTSW 5 120602506 nonsense probably null
R6556:Iqcd UTSW 5 120602378 missense probably damaging 0.99
R6634:Iqcd UTSW 5 120600491 missense probably benign 0.14
R7067:Iqcd UTSW 5 120605147 missense probably damaging 1.00
R7672:Iqcd UTSW 5 120606816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGCATAGGACGAATACGAG -3'
(R):5'- ACAGAACAGGGGCTTGGTTG -3'

Sequencing Primer
(F):5'- TACGAGGACCTGGAGAGCATC -3'
(R):5'- CTTGGTTGGGACCCGGTAG -3'
Posted On2018-05-04