Incidental Mutation 'R6387:Sympk'
List |< first << previous [record 37 of 43] next >> last >|
ID514652
Institutional Source Beutler Lab
Gene Symbol Sympk
Ensembl Gene ENSMUSG00000023118
Gene Namesymplekin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19024377-19054618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19052498 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1009 (Y1009H)
Ref Sequence ENSEMBL: ENSMUSP00000023882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000035521] [ENSMUST00000076887] [ENSMUST00000146903]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023882
AA Change: Y1009H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118
AA Change: Y1009H

DomainStartEndE-ValueType
low complexity region 106 118 N/A INTRINSIC
Pfam:DUF3453 119 352 1.1e-63 PFAM
low complexity region 473 485 N/A INTRINSIC
Pfam:Symplekin_C 887 1068 4.3e-78 PFAM
low complexity region 1123 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035521
SMART Domains Protein: ENSMUSP00000046526
Gene: ENSMUSG00000040866

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 191 685 2.3e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076887
SMART Domains Protein: ENSMUSP00000076153
Gene: ENSMUSG00000040866

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 188 287 3e-18 PFAM
Pfam:Radial_spoke 285 433 4.6e-53 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000130328
AA Change: Y32H
SMART Domains Protein: ENSMUSP00000115900
Gene: ENSMUSG00000023118
AA Change: Y32H

DomainStartEndE-ValueType
Pfam:Symplekin_C 1 92 3.9e-44 PFAM
low complexity region 125 143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144991
Predicted Effect probably benign
Transcript: ENSMUST00000146903
SMART Domains Protein: ENSMUSP00000138740
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:DUF3453 117 230 1.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148861
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that functions in the regulation of polyadenylation and promotes gene expression. The protein forms a high-molecular weight complex with components of the polyadenylation machinery. It is thought to serve as a scaffold for recruiting regulatory factors to the polyadenylation complex. It also participates in 3'-end maturation of histone mRNAs, which do not undergo polyadenylation. The protein also localizes to the cytoplasmic plaques of tight junctions in some cell types. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous ofr a transgenic gene disruption exhibit anemia at E15 and hydrops fetalis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Sympk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Sympk APN 7 19047573 missense probably benign 0.14
IGL01834:Sympk APN 7 19043435 missense probably benign 0.02
IGL02588:Sympk APN 7 19042625 missense probably benign
IGL02601:Sympk APN 7 19048869 missense probably benign 0.31
IGL02645:Sympk APN 7 19052424 missense probably damaging 0.99
IGL02698:Sympk APN 7 19045634 missense probably benign 0.35
IGL02709:Sympk APN 7 19047538 missense probably benign 0.26
IGL02814:Sympk APN 7 19053273 missense probably damaging 1.00
IGL03198:Sympk APN 7 19044996 missense possibly damaging 0.92
butterfinger UTSW 7 19048453 missense probably damaging 0.98
fifth_avenue UTSW 7 19043460 missense possibly damaging 0.83
IGL02991:Sympk UTSW 7 19030577 missense probably damaging 1.00
R0391:Sympk UTSW 7 19046849 missense probably benign 0.06
R1036:Sympk UTSW 7 19048453 missense probably damaging 0.98
R1872:Sympk UTSW 7 19029145 missense probably benign
R2058:Sympk UTSW 7 19043529 missense probably damaging 1.00
R2103:Sympk UTSW 7 19054116 missense probably benign
R2966:Sympk UTSW 7 19030544 missense probably damaging 1.00
R3110:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3112:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3703:Sympk UTSW 7 19040561 missense probably damaging 0.99
R3775:Sympk UTSW 7 19035955 missense probably damaging 1.00
R3930:Sympk UTSW 7 19047522 missense possibly damaging 0.90
R4638:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4639:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4645:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4688:Sympk UTSW 7 19054410 missense probably benign
R5050:Sympk UTSW 7 19036042 missense probably benign 0.19
R5051:Sympk UTSW 7 19036042 missense probably benign 0.19
R5052:Sympk UTSW 7 19036042 missense probably benign 0.19
R5092:Sympk UTSW 7 19042659 missense probably benign 0.17
R5211:Sympk UTSW 7 19035889 missense probably benign 0.22
R5591:Sympk UTSW 7 19054039 missense probably damaging 1.00
R5678:Sympk UTSW 7 19049472 critical splice donor site probably null
R5972:Sympk UTSW 7 19046824 missense probably benign
R6543:Sympk UTSW 7 19036830 missense probably damaging 1.00
R6984:Sympk UTSW 7 19038043 missense probably benign 0.00
R7141:Sympk UTSW 7 19054092 missense probably benign
R7292:Sympk UTSW 7 19036030 missense probably benign 0.01
R7319:Sympk UTSW 7 19035845 missense probably benign
R7887:Sympk UTSW 7 19034439 missense possibly damaging 0.69
R7970:Sympk UTSW 7 19034439 missense possibly damaging 0.69
RF064:Sympk UTSW 7 19034395 frame shift probably null
X0017:Sympk UTSW 7 19040663 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCATTGAGTAGCCTCATAAAGGG -3'
(R):5'- TCTCAGTGTCACCCTGCAAC -3'

Sequencing Primer
(F):5'- GTCTTTTGTGATAAAGATGGAGAAGC -3'
(R):5'- TGTCACCCTGCAACCAGCTG -3'
Posted On2018-05-04