Incidental Mutation 'R6387:Adm'
ID514655
Institutional Source Beutler Lab
Gene Symbol Adm
Ensembl Gene ENSMUSG00000030790
Gene Nameadrenomedullin
SynonymsAM
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location110627661-110629820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110628295 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 6 (I6T)
Ref Sequence ENSEMBL: ENSMUSP00000033054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033054]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033054
AA Change: I6T

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033054
Gene: ENSMUSG00000030790
AA Change: I6T

DomainStartEndE-ValueType
Pfam:Calc_CGRP_IAPP 1 149 2.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186888
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a preprohormone which is cleaved to form two biologically active peptides, adrenomedullin and proadrenomedullin N-terminal 20 peptide. Adrenomedullin is a 52 aa peptide with several functions, including vasodilation, regulation of hormone secretion, promotion of angiogenesis, and antimicrobial activity. The antimicrobial activity is antibacterial, as the peptide has been shown to kill E. coli and S. aureus at low concentration. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiovascular defects, hyrdops fetalis, and lethality at midgestation with defects in placental defects, impaired fetal blood vessel and materal spiral artery remodeling, and decreased uterine NK cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Adm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Adm APN 7 110628581 missense probably damaging 1.00
IGL01950:Adm APN 7 110628900 missense probably damaging 1.00
IGL01965:Adm APN 7 110628625 missense probably benign 0.04
PIT4696001:Adm UTSW 7 110628289 missense probably benign 0.36
R0497:Adm UTSW 7 110629121 missense probably benign
R0630:Adm UTSW 7 110628548 missense probably damaging 1.00
R0879:Adm UTSW 7 110628352 missense possibly damaging 0.93
R1116:Adm UTSW 7 110628294 missense probably benign 0.00
R1595:Adm UTSW 7 110629091 missense probably damaging 1.00
R4880:Adm UTSW 7 110629119 missense probably benign 0.01
R5992:Adm UTSW 7 110627696 start gained probably benign
R6296:Adm UTSW 7 110628354 missense probably benign 0.00
R7181:Adm UTSW 7 110629029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACTTCTCAATGGCTTCC -3'
(R):5'- TCAAGTGATGTCCCAGCCAG -3'

Sequencing Primer
(F):5'- AGCGCAAAAATCTCCGGTGTTTC -3'
(R):5'- GATGTCCCAGCCAGCTCCAC -3'
Posted On2018-05-04