Incidental Mutation 'R6387:Unc5d'
List |< first << previous [record 40 of 43] next >> last >|
ID514657
Institutional Source Beutler Lab
Gene Symbol Unc5d
Ensembl Gene ENSMUSG00000063626
Gene Nameunc-5 netrin receptor D
SynonymsUnc5h4, D930029E11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location28646717-29219636 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 28875526 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 144 (K144*)
Ref Sequence ENSEMBL: ENSMUSP00000147306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168630] [ENSMUST00000209401] [ENSMUST00000210298] [ENSMUST00000210785] [ENSMUST00000211448]
Predicted Effect probably null
Transcript: ENSMUST00000168630
AA Change: K144*
SMART Domains Protein: ENSMUSP00000128521
Gene: ENSMUSG00000063626
AA Change: K144*

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1cs6a2 52 146 5e-3 SMART
IGc2 169 236 2.66e-8 SMART
TSP1 253 304 2.29e-13 SMART
TSP1 309 358 6.33e-7 SMART
transmembrane domain 383 405 N/A INTRINSIC
Pfam:ZU5 545 642 1.6e-33 PFAM
DEATH 850 941 4.77e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000209401
AA Change: K144*
Predicted Effect probably null
Transcript: ENSMUST00000210298
AA Change: K144*
Predicted Effect probably null
Transcript: ENSMUST00000210785
AA Change: K144*
Predicted Effect probably null
Transcript: ENSMUST00000211448
AA Change: K144*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Mice exhibit impaired induced growth cone collapse response and accelerated radial migration of cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Unc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Unc5d APN 8 28719826 missense probably damaging 0.97
IGL00687:Unc5d APN 8 28715813 splice site probably benign
IGL00970:Unc5d APN 8 28696428 missense probably benign 0.15
IGL01992:Unc5d APN 8 28652791 missense probably damaging 0.98
IGL02024:Unc5d APN 8 28652827 missense probably benign 0.08
IGL02080:Unc5d APN 8 28891288 splice site probably null
IGL02902:Unc5d APN 8 28875606 missense probably damaging 1.00
IGL02982:Unc5d APN 8 28652853 missense probably damaging 1.00
R0071:Unc5d UTSW 8 28719826 missense possibly damaging 0.62
R0071:Unc5d UTSW 8 28719826 missense possibly damaging 0.62
R0761:Unc5d UTSW 8 28696532 intron probably null
R0941:Unc5d UTSW 8 28759027 missense possibly damaging 0.85
R1086:Unc5d UTSW 8 28875630 missense possibly damaging 0.87
R1625:Unc5d UTSW 8 28683206 missense probably damaging 1.00
R1635:Unc5d UTSW 8 28760749 missense probably benign 0.14
R1682:Unc5d UTSW 8 28759081 missense probably damaging 1.00
R1698:Unc5d UTSW 8 28696478 missense probably damaging 0.99
R2015:Unc5d UTSW 8 28758979 missense probably damaging 1.00
R2132:Unc5d UTSW 8 28875529 missense possibly damaging 0.50
R2174:Unc5d UTSW 8 28694540 missense probably damaging 0.99
R2210:Unc5d UTSW 8 28761797 missense probably damaging 0.97
R3684:Unc5d UTSW 8 28694592 missense probably damaging 1.00
R3734:Unc5d UTSW 8 28761798 missense probably benign 0.02
R4093:Unc5d UTSW 8 28844837 missense possibly damaging 0.87
R4287:Unc5d UTSW 8 28719796 missense probably benign 0.00
R4888:Unc5d UTSW 8 28666899 missense probably benign 0.02
R5000:Unc5d UTSW 8 28715747 missense possibly damaging 0.90
R5060:Unc5d UTSW 8 28719695 missense probably benign 0.00
R5076:Unc5d UTSW 8 28694676 missense possibly damaging 0.88
R5696:Unc5d UTSW 8 28666842 missense probably benign 0.06
R6024:Unc5d UTSW 8 28875511 missense possibly damaging 0.96
R6077:Unc5d UTSW 8 28675307 missense possibly damaging 0.94
R6259:Unc5d UTSW 8 28666792 missense probably benign 0.00
R7038:Unc5d UTSW 8 28715721 critical splice donor site probably null
R7577:Unc5d UTSW 8 28891421 missense probably damaging 1.00
R7641:Unc5d UTSW 8 28719975 missense probably damaging 1.00
X0058:Unc5d UTSW 8 28760730 missense probably benign 0.12
X0060:Unc5d UTSW 8 28694676 missense possibly damaging 0.88
Z1176:Unc5d UTSW 8 28759053 missense probably damaging 1.00
Z1177:Unc5d UTSW 8 28891308 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAAAAGTCCATCTTGCTTCCC -3'
(R):5'- AGAAAAGGTTTGGCTGGCCTTAC -3'

Sequencing Primer
(F):5'- TCTACATTCTGCAGAAGACCAGG -3'
(R):5'- CCTTACCTTTGTGATTGAGGAGTAC -3'
Posted On2018-05-04