Incidental Mutation 'R6387:Icam4'
ID514659
Institutional Source Beutler Lab
Gene Symbol Icam4
Ensembl Gene ENSMUSG00000001014
Gene Nameintercellular adhesion molecule 4, Landsteiner-Wiener blood group
SynonymsCd242, 1810015M19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location21029373-21030595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21030209 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 215 (S215R)
Ref Sequence ENSEMBL: ENSMUSP00000151013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001040] [ENSMUST00000019616] [ENSMUST00000086399] [ENSMUST00000215077]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001040
AA Change: S215R

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001040
Gene: ENSMUSG00000001014
AA Change: S215R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ICAM_N 37 128 2.5e-17 PFAM
Blast:IG_like 133 224 1e-9 BLAST
transmembrane domain 232 254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019616
SMART Domains Protein: ENSMUSP00000019616
Gene: ENSMUSG00000032174

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:ICAM_N 32 122 1.5e-17 PFAM
Pfam:Ig_3 121 202 5.6e-4 PFAM
low complexity region 284 292 N/A INTRINSIC
IG_like 329 405 1.45e1 SMART
IG 416 488 1.72e-2 SMART
IG 499 569 5.84e-5 SMART
IG_like 580 662 3.57e1 SMART
IG 673 742 3.49e-3 SMART
IGc2 758 819 1.97e-11 SMART
transmembrane domain 833 855 N/A INTRINSIC
low complexity region 884 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086399
SMART Domains Protein: ENSMUSP00000083587
Gene: ENSMUSG00000037405

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
IG_like 33 109 5.91e1 SMART
IG_like 119 208 1.15e2 SMART
IG 319 396 1.49e-2 SMART
IG 407 479 3.91e-6 SMART
transmembrane domain 486 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180870
Predicted Effect possibly damaging
Transcript: ENSMUST00000215077
AA Change: S215R

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216917
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the Landsteiner-Wiener (LW) blood group antigen(s) that belongs to the immunoglobulin (Ig) superfamily, and that shares similarity with the intercellular adhesion molecule (ICAM) protein family. This ICAM protein contains 2 Ig-like C2-type domains and binds to the leukocyte adhesion LFA-1 protein. The molecular basis of the LW(A)/LW(B) blood group antigens is a single aa variation at position 100; Gln-100=LW(A) and Arg-100=LW(B). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased erythroblastic island formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Icam4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Icam4 APN 9 21030086 missense possibly damaging 0.90
IGL01835:Icam4 APN 9 21029790 missense probably damaging 1.00
IGL02707:Icam4 APN 9 21030474 missense possibly damaging 0.89
R0360:Icam4 UTSW 9 21029821 missense probably damaging 1.00
R0507:Icam4 UTSW 9 21029503 missense possibly damaging 0.55
R5037:Icam4 UTSW 9 21029641 nonsense probably null
R6084:Icam4 UTSW 9 21029539 missense probably benign 0.01
R6315:Icam4 UTSW 9 21029952 missense probably damaging 1.00
R6379:Icam4 UTSW 9 21029782 missense probably damaging 1.00
R6931:Icam4 UTSW 9 21030451 missense probably damaging 0.97
R7768:Icam4 UTSW 9 21029994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATGTGACACACGTGTTC -3'
(R):5'- TAGAGGCTGGGCTTAAAGCTG -3'

Sequencing Primer
(F):5'- TGACACACGTGTTCCCAGTG -3'
(R):5'- GGCTTAAAGCTGTGGGCAG -3'
Posted On2018-05-04