Incidental Mutation 'R6387:Olfr979'
ID514660
Institutional Source Beutler Lab
Gene Symbol Olfr979
Ensembl Gene ENSMUSG00000059473
Gene Nameolfactory receptor 979
SynonymsMOR223-1, GA_x6K02T2PVTD-33699706-33698771
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39998003-40003465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40000852 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 125 (I125T)
Ref Sequence ENSEMBL: ENSMUSP00000148903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080835] [ENSMUST00000215523] [ENSMUST00000216463]
Predicted Effect probably damaging
Transcript: ENSMUST00000080835
AA Change: I125T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079648
Gene: ENSMUSG00000059473
AA Change: I125T

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 7.9e-58 PFAM
Pfam:7tm_1 39 287 5.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215523
AA Change: I125T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000216463
Meta Mutation Damage Score 0.4590 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Olfr979
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Olfr979 APN 9 40000886 missense probably damaging 1.00
IGL02939:Olfr979 APN 9 40000898 missense probably benign 0.26
IGL02991:Olfr979 UTSW 9 40000402 missense probably damaging 1.00
R1388:Olfr979 UTSW 9 40000652 missense probably damaging 0.99
R1572:Olfr979 UTSW 9 40001194 missense probably benign 0.35
R2089:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2091:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2091:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2179:Olfr979 UTSW 9 40000924 missense probably benign 0.44
R3424:Olfr979 UTSW 9 40000534 missense probably damaging 0.97
R3964:Olfr979 UTSW 9 40000471 missense possibly damaging 0.95
R3965:Olfr979 UTSW 9 40000471 missense possibly damaging 0.95
R4111:Olfr979 UTSW 9 40000898 nonsense probably null
R4537:Olfr979 UTSW 9 40000320 missense probably benign 0.01
R4737:Olfr979 UTSW 9 40000422 missense probably damaging 0.96
R4926:Olfr979 UTSW 9 40001023 unclassified probably null
R5303:Olfr979 UTSW 9 40000588 missense probably damaging 1.00
R5587:Olfr979 UTSW 9 40000621 missense possibly damaging 0.90
R6394:Olfr979 UTSW 9 40000705 missense probably benign 0.04
R6765:Olfr979 UTSW 9 40001197 missense probably damaging 1.00
R7312:Olfr979 UTSW 9 40000810 missense probably benign 0.22
R7463:Olfr979 UTSW 9 40000564 missense probably benign 0.07
R7486:Olfr979 UTSW 9 40000885 missense probably benign 0.39
R7581:Olfr979 UTSW 9 40000422 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGTGCATCACAGAAATAATGC -3'
(R):5'- GATGGTAATCAGGGTGGACTCC -3'

Sequencing Primer
(F):5'- CATCACAGAAATAATGCTGGATCTGG -3'
(R):5'- CAACCTCTCCTTTATTGATATGTGG -3'
Posted On2018-05-04