Incidental Mutation 'R6387:Smad3'
ID514661
Institutional Source Beutler Lab
Gene Symbol Smad3
Ensembl Gene ENSMUSG00000032402
Gene NameSMAD family member 3
SynonymsMadh3, Smad 3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location63646767-63757994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63654765 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 310 (D310E)
Ref Sequence ENSEMBL: ENSMUSP00000034973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034973] [ENSMUST00000137713] [ENSMUST00000154323]
Predicted Effect probably benign
Transcript: ENSMUST00000034973
AA Change: D310E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034973
Gene: ENSMUSG00000032402
AA Change: D310E

DomainStartEndE-ValueType
DWA 26 134 5.63e-68 SMART
Blast:DWB 189 219 8e-12 BLAST
DWB 230 401 6.93e-109 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137713
SMART Domains Protein: ENSMUSP00000121671
Gene: ENSMUSG00000032402

DomainStartEndE-ValueType
DWB 35 113 3.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154323
SMART Domains Protein: ENSMUSP00000116790
Gene: ENSMUSG00000032402

DomainStartEndE-ValueType
DWA 1 69 5.6e-22 SMART
Pfam:MH2 161 233 3.9e-31 PFAM
Meta Mutation Damage Score 0.1961 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions as a transcriptional modulator activated by transforming growth factor-beta and is thought to play a role in the regulation of carcinogenesis. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygotes for targeted mutations exhibit reduced mucosal immunity, chronic intestinal inflammation (sometimes with colonic adenocarcinoma), forelimb malformation, reduced mineralization of enamel, impaired growth of ovarian follicles, and develop osteoarthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Smad3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Smad3 APN 9 63655586 missense probably damaging 0.98
IGL01946:Smad3 APN 9 63757553 missense probably damaging 1.00
IGL02672:Smad3 APN 9 63667727 critical splice donor site probably null
IGL02686:Smad3 APN 9 63667782 missense probably damaging 1.00
IGL03205:Smad3 APN 9 63667866 missense probably benign 0.12
noseeem UTSW 9 63654717 nonsense probably null
R4555:Smad3 UTSW 9 63654788 missense possibly damaging 0.71
R4736:Smad3 UTSW 9 63757560 missense probably damaging 1.00
R7167:Smad3 UTSW 9 63666153 missense probably benign 0.00
R7591:Smad3 UTSW 9 63654717 nonsense probably null
R7961:Smad3 UTSW 9 63650282 missense possibly damaging 0.70
R8303:Smad3 UTSW 9 63667478 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTTCTCTAGGTCAGTGGC -3'
(R):5'- TGCTTTAGGAACCCAGAGCTG -3'

Sequencing Primer
(F):5'- GCGCACAGACATGTACAGTGTC -3'
(R):5'- AGAGCTGCCCACCATTCTC -3'
Posted On2018-05-04