Incidental Mutation 'R6387:Chad'
ID514668
Institutional Source Beutler Lab
Gene Symbol Chad
Ensembl Gene ENSMUSG00000039084
Gene Namechondroadherin
SynonymsSLRR4A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94565047-94569127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94567837 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 271 (H271Y)
Ref Sequence ENSEMBL: ENSMUSP00000047844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040418] [ENSMUST00000103164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040418
AA Change: H271Y

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047844
Gene: ENSMUSG00000039084
AA Change: H271Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 21 54 1.7e-7 SMART
LRR_TYP 73 96 9.58e-3 SMART
LRR_TYP 97 120 1.45e-2 SMART
LRR_TYP 121 144 1.69e-3 SMART
LRR_TYP 145 168 6.42e-4 SMART
LRR 170 192 2.2e1 SMART
LRR 193 216 2.14e1 SMART
LRR_TYP 217 240 4.17e-3 SMART
LRR 245 265 2.27e2 SMART
LRR 266 289 3.36e1 SMART
LRRCT 299 346 1.1e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103164
SMART Domains Protein: ENSMUSP00000099453
Gene: ENSMUSG00000076435

DomainStartEndE-ValueType
Pfam:AMP-binding 78 516 3.9e-100 PFAM
Pfam:AMP-binding_C 524 599 1.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155122
Meta Mutation Damage Score 0.0988 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chondroadherin is a cartilage matrix protein thought to mediate adhesion of isolated chondrocytes. The protein contains 11 leucine-rich repeats flanked by cysteine-rich regions. The chondroadherin messenger RNA is present in chondrocytes at all ages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit widened epiphyseal growth plate, abnormal tracbecular and cortical bone morphology and lower femoral neck failure load and tibial strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Chad
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1393:Chad UTSW 11 94565314 missense probably benign
R1480:Chad UTSW 11 94565137 intron probably benign
R1855:Chad UTSW 11 94565477 missense probably damaging 1.00
R1924:Chad UTSW 11 94565558 missense possibly damaging 0.59
R2115:Chad UTSW 11 94568226 missense probably benign 0.01
R2255:Chad UTSW 11 94565697 missense possibly damaging 0.82
R4418:Chad UTSW 11 94567837 missense possibly damaging 0.90
R4847:Chad UTSW 11 94568327 missense probably benign 0.00
R4948:Chad UTSW 11 94565702 missense probably damaging 1.00
R5441:Chad UTSW 11 94568292 missense probably benign 0.01
R5511:Chad UTSW 11 94565246 missense probably damaging 1.00
R6528:Chad UTSW 11 94565624 missense probably damaging 1.00
R7751:Chad UTSW 11 94565173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGGATGACATCATTGTGGC -3'
(R):5'- TCAGTACCCGACATGCTAGGTAG -3'

Sequencing Primer
(F):5'- ATTGTGGCTCCTCAACAGG -3'
(R):5'- TAGGATGTCCAGGCTGTCCTAC -3'
Posted On2018-05-04