Incidental Mutation 'R6387:Mrps27'
ID514674
Institutional Source Beutler Lab
Gene Symbol Mrps27
Ensembl Gene ENSMUSG00000041632
Gene Namemitochondrial ribosomal protein S27
Synonyms2610028H14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location99344786-99415562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99400317 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 113 (I113V)
Ref Sequence ENSEMBL: ENSMUSP00000156296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052249] [ENSMUST00000224660]
Predicted Effect probably benign
Transcript: ENSMUST00000052249
AA Change: I113V

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062326
Gene: ENSMUSG00000041632
AA Change: I113V

DomainStartEndE-ValueType
Pfam:MRP-S27 1 413 8.3e-156 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180491
Predicted Effect possibly damaging
Transcript: ENSMUST00000224660
AA Change: I113V

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225973
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that may be a functional partner of the death associated protein 3 (DAP3). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Mrps27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Mrps27 APN 13 99409816 missense probably damaging 1.00
IGL01685:Mrps27 APN 13 99414920 missense possibly damaging 0.52
P0043:Mrps27 UTSW 13 99412246 missense probably benign
R0122:Mrps27 UTSW 13 99365228 missense probably benign 0.13
R0502:Mrps27 UTSW 13 99409795 splice site probably benign
R0503:Mrps27 UTSW 13 99409795 splice site probably benign
R0611:Mrps27 UTSW 13 99405074 missense probably damaging 1.00
R1540:Mrps27 UTSW 13 99405050 missense probably benign 0.17
R2566:Mrps27 UTSW 13 99400328 nonsense probably null
R4227:Mrps27 UTSW 13 99411340 missense probably damaging 1.00
R4235:Mrps27 UTSW 13 99405041 missense probably damaging 1.00
R4715:Mrps27 UTSW 13 99414815 unclassified probably null
R4761:Mrps27 UTSW 13 99412231 missense probably benign 0.10
R5114:Mrps27 UTSW 13 99411465 unclassified probably benign
R5294:Mrps27 UTSW 13 99409873 missense probably damaging 1.00
R6241:Mrps27 UTSW 13 99412246 missense probably benign
R6491:Mrps27 UTSW 13 99363030 missense probably damaging 1.00
R6992:Mrps27 UTSW 13 99405014 missense probably benign 0.16
R7165:Mrps27 UTSW 13 99414799 missense possibly damaging 0.89
R7241:Mrps27 UTSW 13 99411280 nonsense probably null
R7709:Mrps27 UTSW 13 99404996 missense probably benign 0.21
R7720:Mrps27 UTSW 13 99401330 missense unknown
Z1177:Mrps27 UTSW 13 99414843 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TCTATTAATTGTCGATGCTCATGAC -3'
(R):5'- AGCTCCGGTCTACAAACAGC -3'

Sequencing Primer
(F):5'- GATGCTCATGACTTTTTGATCACAC -3'
(R):5'- ACCTTAATAGGAAAGTGGTTTCTGG -3'
Posted On2018-05-04