Incidental Mutation 'R6387:Gdf10'
ID514676
Institutional Source Beutler Lab
Gene Symbol Gdf10
Ensembl Gene ENSMUSG00000021943
Gene Namegrowth differentiation factor 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location33923587-33937983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33924004 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 37 (S37T)
Ref Sequence ENSEMBL: ENSMUSP00000128621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168727]
Predicted Effect probably benign
Transcript: ENSMUST00000168727
AA Change: S37T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128621
Gene: ENSMUSG00000021943
AA Change: S37T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
TGFB 374 476 1e-50 SMART
Meta Mutation Damage Score 0.0827 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein has been shown to promote neural repair after stroke and may act as a tumor suppressor. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for disruption of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Gdf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Gdf10 APN 14 33923980 missense probably benign
IGL03203:Gdf10 APN 14 33934473 missense possibly damaging 0.94
R0178:Gdf10 UTSW 14 33924101 missense probably damaging 1.00
R0890:Gdf10 UTSW 14 33932156 missense possibly damaging 0.57
R1218:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1219:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1221:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1670:Gdf10 UTSW 14 33932043 missense possibly damaging 0.92
R1956:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1957:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1958:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R2154:Gdf10 UTSW 14 33934389 missense probably damaging 0.99
R2260:Gdf10 UTSW 14 33932277 missense probably damaging 1.00
R2971:Gdf10 UTSW 14 33924191 missense probably damaging 1.00
R3896:Gdf10 UTSW 14 33934481 missense probably damaging 1.00
R4027:Gdf10 UTSW 14 33932615 missense probably damaging 1.00
R4393:Gdf10 UTSW 14 33932738 missense probably damaging 1.00
R4782:Gdf10 UTSW 14 33931913 missense probably benign 0.00
R5436:Gdf10 UTSW 14 33932256 missense probably damaging 0.97
R5829:Gdf10 UTSW 14 33932717 missense probably damaging 0.99
R8346:Gdf10 UTSW 14 33931845 missense probably benign 0.00
R8742:Gdf10 UTSW 14 33932469 missense probably benign 0.00
Z1088:Gdf10 UTSW 14 33932390 missense probably damaging 1.00
Z1176:Gdf10 UTSW 14 33932532 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AACACTGAGCCCTCCTTGTC -3'
(R):5'- ATGGATTAGGACTCCCGGTG -3'

Sequencing Primer
(F):5'- GTCTGTTCTCCTGGGCTCAGAC -3'
(R):5'- GATTAGGACTCCCGGTGCATCTTC -3'
Posted On2018-05-04