Incidental Mutation 'R6387:Trio'
ID 514677
Institutional Source Beutler Lab
Gene Symbol Trio
Ensembl Gene ENSMUSG00000022263
Gene Name triple functional domain (PTPRF interacting)
Synonyms Solo, 6720464I07Rik
MMRRC Submission 044536-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6387 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 27730737-28025934 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27752825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1026 (F1026L)
Ref Sequence ENSEMBL: ENSMUSP00000154309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000090247
AA Change: F2170L

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: F2170L

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
SEC14 68 207 3.4e-26 SMART
SPEC 221 337 2.48e-9 SMART
SPEC 343 445 1.92e-15 SMART
SPEC 569 671 5.35e-14 SMART
SPEC 674 783 1.18e-6 SMART
SPEC 910 1011 2.6e-12 SMART
SPEC 1141 1243 7e-18 SMART
low complexity region 1249 1258 N/A INTRINSIC
RhoGEF 1296 1466 2.79e-53 SMART
PH 1480 1593 1.53e-9 SMART
SH3 1659 1720 1.9e-8 SMART
low complexity region 1788 1802 N/A INTRINSIC
low complexity region 1837 1863 N/A INTRINSIC
low complexity region 1936 1954 N/A INTRINSIC
RhoGEF 1973 2144 1.32e-63 SMART
PH 2158 2273 3.6e-6 SMART
low complexity region 2291 2341 N/A INTRINSIC
low complexity region 2371 2390 N/A INTRINSIC
low complexity region 2491 2503 N/A INTRINSIC
SH3 2558 2619 1.04e0 SMART
low complexity region 2640 2660 N/A INTRINSIC
IGc2 2701 2770 4e-12 SMART
S_TKc 2800 3054 4.84e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226644
AA Change: F1026L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227030
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,884,881 (GRCm39) K326E possibly damaging Het
Acot1 A G 12: 84,056,627 (GRCm39) D115G probably benign Het
Adm T C 7: 110,227,502 (GRCm39) I6T possibly damaging Het
Ahi1 A G 10: 20,844,942 (GRCm39) Y349C probably damaging Het
Aldh1a1 A G 19: 20,595,323 (GRCm39) E84G probably damaging Het
Ankrd31 A G 13: 96,967,081 (GRCm39) D520G probably damaging Het
Ano4 A T 10: 88,807,267 (GRCm39) Y736* probably null Het
Atp6v1a A G 16: 43,907,806 (GRCm39) F612S possibly damaging Het
Bltp3b C T 10: 89,638,919 (GRCm39) Q442* probably null Het
Calcb G A 7: 114,319,025 (GRCm39) V17I possibly damaging Het
Cfap70 C T 14: 20,498,643 (GRCm39) V15M probably damaging Het
Chad C T 11: 94,458,663 (GRCm39) H271Y possibly damaging Het
Csgalnact1 C T 8: 68,811,365 (GRCm39) G435D probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Eprs1 T A 1: 185,119,281 (GRCm39) M487K possibly damaging Het
Fat4 A G 3: 39,037,934 (GRCm39) E3862G probably damaging Het
Gdf10 T A 14: 33,645,961 (GRCm39) S37T probably benign Het
Hhatl T A 9: 121,619,467 (GRCm39) H39L probably benign Het
Icam4 A C 9: 20,941,505 (GRCm39) S215R possibly damaging Het
Ighv1-18 T C 12: 114,646,280 (GRCm39) E108G probably damaging Het
Iqcd T C 5: 120,744,920 (GRCm39) I416T probably benign Het
Marf1 T A 16: 13,959,504 (GRCm39) *577L probably null Het
Mark2 A G 19: 7,263,267 (GRCm39) F167L probably damaging Het
Mpdz T C 4: 81,299,946 (GRCm39) T351A possibly damaging Het
Mrps27 A G 13: 99,536,825 (GRCm39) I113V possibly damaging Het
Numbl C T 7: 26,976,115 (GRCm39) T265I probably damaging Het
Obsl1 C T 1: 75,468,006 (GRCm39) A1296T probably benign Het
Or10g9 A G 9: 39,912,148 (GRCm39) I125T probably damaging Het
Pcdhb21 A G 18: 37,648,385 (GRCm39) I505V probably benign Het
Pfas A G 11: 68,891,291 (GRCm39) F269L probably damaging Het
Prkdc G A 16: 15,516,679 (GRCm39) V1018I probably benign Het
Prl4a1 T A 13: 28,202,482 (GRCm39) V19E possibly damaging Het
Ptpn22 A G 3: 103,792,702 (GRCm39) D327G probably benign Het
Smad3 G T 9: 63,562,047 (GRCm39) D310E probably benign Het
Sparcl1 T A 5: 104,232,926 (GRCm39) D625V probably damaging Het
Spta1 G A 1: 174,058,899 (GRCm39) A1945T probably benign Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Sympk T C 7: 18,786,423 (GRCm39) Y1009H possibly damaging Het
Unc5d T A 8: 29,365,554 (GRCm39) K144* probably null Het
Unk A G 11: 115,945,766 (GRCm39) N479S possibly damaging Het
Zfp710 T C 7: 79,735,775 (GRCm39) I514T probably damaging Het
Zfp993 A G 4: 146,741,975 (GRCm39) T100A probably damaging Het
Other mutations in Trio
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Trio APN 15 27,912,829 (GRCm39) splice site probably benign
IGL01011:Trio APN 15 27,736,575 (GRCm39) missense probably damaging 0.96
IGL01090:Trio APN 15 27,773,093 (GRCm39) missense probably damaging 1.00
IGL01145:Trio APN 15 27,818,253 (GRCm39) splice site probably benign
IGL01147:Trio APN 15 27,881,406 (GRCm39) missense probably damaging 1.00
IGL01161:Trio APN 15 27,749,867 (GRCm39) missense probably damaging 1.00
IGL01324:Trio APN 15 27,905,409 (GRCm39) missense probably benign 0.42
IGL01352:Trio APN 15 27,901,315 (GRCm39) missense probably benign 0.01
IGL01366:Trio APN 15 27,732,954 (GRCm39) missense possibly damaging 0.76
IGL01443:Trio APN 15 27,838,861 (GRCm39) splice site probably benign
IGL01454:Trio APN 15 27,833,071 (GRCm39) missense probably benign 0.32
IGL01695:Trio APN 15 27,773,087 (GRCm39) missense probably damaging 1.00
IGL01765:Trio APN 15 27,764,112 (GRCm39) missense possibly damaging 0.85
IGL01860:Trio APN 15 27,846,896 (GRCm39) missense probably damaging 1.00
IGL01879:Trio APN 15 27,741,119 (GRCm39) missense probably benign 0.12
IGL01991:Trio APN 15 27,871,360 (GRCm39) missense possibly damaging 0.95
IGL02106:Trio APN 15 27,744,244 (GRCm39) missense possibly damaging 0.85
IGL02209:Trio APN 15 27,744,139 (GRCm39) missense probably damaging 1.00
IGL02232:Trio APN 15 27,902,647 (GRCm39) missense probably benign 0.24
IGL02304:Trio APN 15 27,735,522 (GRCm39) missense probably damaging 0.96
IGL02504:Trio APN 15 27,847,476 (GRCm39) nonsense probably null
IGL02508:Trio APN 15 27,818,190 (GRCm39) missense possibly damaging 0.65
IGL02541:Trio APN 15 27,845,016 (GRCm39) splice site probably benign
IGL02617:Trio APN 15 27,841,935 (GRCm39) splice site probably benign
IGL02675:Trio APN 15 27,768,125 (GRCm39) unclassified probably benign
IGL02817:Trio APN 15 27,902,967 (GRCm39) missense probably benign 0.01
IGL02993:Trio APN 15 27,830,325 (GRCm39) splice site probably benign
IGL03007:Trio APN 15 27,902,828 (GRCm39) missense probably damaging 0.99
IGL03135:Trio APN 15 27,832,097 (GRCm39) splice site probably benign
IGL03225:Trio APN 15 27,902,781 (GRCm39) missense probably benign 0.30
R0063:Trio UTSW 15 27,881,523 (GRCm39) splice site probably benign
R0063:Trio UTSW 15 27,881,523 (GRCm39) splice site probably benign
R0302:Trio UTSW 15 27,902,603 (GRCm39) missense probably damaging 1.00
R0505:Trio UTSW 15 27,767,993 (GRCm39) missense probably benign 0.00
R0506:Trio UTSW 15 27,855,049 (GRCm39) missense probably benign 0.12
R0564:Trio UTSW 15 27,805,908 (GRCm39) missense probably damaging 1.00
R0659:Trio UTSW 15 27,831,485 (GRCm39) missense probably damaging 0.97
R0882:Trio UTSW 15 27,732,980 (GRCm39) missense probably damaging 1.00
R0939:Trio UTSW 15 27,741,336 (GRCm39) critical splice donor site probably null
R1018:Trio UTSW 15 27,871,257 (GRCm39) missense probably damaging 1.00
R1439:Trio UTSW 15 27,898,000 (GRCm39) missense probably damaging 1.00
R1456:Trio UTSW 15 27,753,890 (GRCm39) splice site probably benign
R1488:Trio UTSW 15 27,741,053 (GRCm39) missense probably damaging 1.00
R1522:Trio UTSW 15 27,732,726 (GRCm39) missense probably benign 0.28
R1531:Trio UTSW 15 27,833,071 (GRCm39) missense probably benign 0.32
R1640:Trio UTSW 15 27,833,130 (GRCm39) missense probably damaging 1.00
R1646:Trio UTSW 15 27,758,433 (GRCm39) missense possibly damaging 0.91
R1682:Trio UTSW 15 27,744,232 (GRCm39) splice site probably null
R1780:Trio UTSW 15 27,744,124 (GRCm39) missense possibly damaging 0.93
R1791:Trio UTSW 15 27,841,842 (GRCm39) missense probably damaging 1.00
R1803:Trio UTSW 15 27,748,426 (GRCm39) missense probably benign
R1817:Trio UTSW 15 27,742,581 (GRCm39) nonsense probably null
R1853:Trio UTSW 15 27,756,622 (GRCm39) missense probably damaging 1.00
R1898:Trio UTSW 15 27,742,466 (GRCm39) missense possibly damaging 0.52
R1937:Trio UTSW 15 27,833,142 (GRCm39) missense probably damaging 1.00
R1938:Trio UTSW 15 27,732,977 (GRCm39) missense probably damaging 0.98
R2025:Trio UTSW 15 27,774,013 (GRCm39) missense probably damaging 1.00
R2025:Trio UTSW 15 27,744,223 (GRCm39) missense probably damaging 0.99
R2050:Trio UTSW 15 27,852,031 (GRCm39) missense possibly damaging 0.85
R2186:Trio UTSW 15 27,824,061 (GRCm39) splice site probably null
R2913:Trio UTSW 15 27,854,998 (GRCm39) missense probably damaging 1.00
R3151:Trio UTSW 15 27,805,862 (GRCm39) missense probably damaging 1.00
R3771:Trio UTSW 15 27,748,177 (GRCm39) missense probably damaging 0.98
R3773:Trio UTSW 15 27,748,177 (GRCm39) missense probably damaging 0.98
R3826:Trio UTSW 15 27,833,156 (GRCm39) missense probably damaging 1.00
R4015:Trio UTSW 15 27,744,187 (GRCm39) missense possibly damaging 0.71
R4359:Trio UTSW 15 27,749,883 (GRCm39) nonsense probably null
R4370:Trio UTSW 15 27,748,423 (GRCm39) nonsense probably null
R4547:Trio UTSW 15 27,819,068 (GRCm39) missense possibly damaging 0.89
R4573:Trio UTSW 15 27,773,084 (GRCm39) small deletion probably benign
R4620:Trio UTSW 15 27,871,257 (GRCm39) missense probably damaging 1.00
R4735:Trio UTSW 15 27,752,875 (GRCm39) splice site probably null
R4764:Trio UTSW 15 27,732,624 (GRCm39) nonsense probably null
R4775:Trio UTSW 15 27,881,428 (GRCm39) nonsense probably null
R4942:Trio UTSW 15 27,752,811 (GRCm39) missense probably benign 0.21
R5004:Trio UTSW 15 27,755,264 (GRCm39) missense probably damaging 1.00
R5149:Trio UTSW 15 27,754,115 (GRCm39) missense possibly damaging 0.74
R5183:Trio UTSW 15 27,902,686 (GRCm39) missense probably benign 0.00
R5186:Trio UTSW 15 27,898,077 (GRCm39) missense probably damaging 0.97
R5268:Trio UTSW 15 27,748,372 (GRCm39) missense probably benign 0.02
R5344:Trio UTSW 15 27,735,618 (GRCm39) missense probably benign 0.12
R5407:Trio UTSW 15 27,844,892 (GRCm39) splice site probably null
R5442:Trio UTSW 15 27,856,280 (GRCm39) missense probably benign 0.04
R5617:Trio UTSW 15 27,902,834 (GRCm39) missense probably benign
R5778:Trio UTSW 15 27,856,250 (GRCm39) missense probably benign 0.33
R5986:Trio UTSW 15 27,852,019 (GRCm39) missense possibly damaging 0.88
R5990:Trio UTSW 15 27,891,545 (GRCm39) missense probably benign 0.10
R6011:Trio UTSW 15 27,735,631 (GRCm39) missense probably damaging 0.98
R6063:Trio UTSW 15 27,891,465 (GRCm39) missense possibly damaging 0.94
R6166:Trio UTSW 15 27,818,157 (GRCm39) missense probably damaging 0.96
R6187:Trio UTSW 15 27,744,038 (GRCm39) critical splice donor site probably null
R6402:Trio UTSW 15 27,902,997 (GRCm39) missense probably benign 0.02
R6478:Trio UTSW 15 27,856,193 (GRCm39) missense probably benign 0.01
R6528:Trio UTSW 15 27,805,956 (GRCm39) missense probably damaging 1.00
R6662:Trio UTSW 15 27,855,082 (GRCm39) missense probably benign 0.00
R6825:Trio UTSW 15 27,889,394 (GRCm39) missense probably damaging 0.98
R6890:Trio UTSW 15 27,919,374 (GRCm39) unclassified probably benign
R6945:Trio UTSW 15 27,824,176 (GRCm39) missense probably damaging 1.00
R7027:Trio UTSW 15 27,805,740 (GRCm39) missense possibly damaging 0.86
R7046:Trio UTSW 15 27,832,137 (GRCm39) missense probably damaging 1.00
R7049:Trio UTSW 15 27,749,885 (GRCm39) missense possibly damaging 0.66
R7075:Trio UTSW 15 27,898,086 (GRCm39) missense unknown
R7094:Trio UTSW 15 27,891,534 (GRCm39) missense unknown
R7123:Trio UTSW 15 27,742,399 (GRCm39) critical splice donor site probably benign
R7130:Trio UTSW 15 27,742,399 (GRCm39) critical splice donor site probably benign
R7214:Trio UTSW 15 27,871,273 (GRCm39) missense probably damaging 0.97
R7292:Trio UTSW 15 27,828,437 (GRCm39) missense possibly damaging 0.63
R7293:Trio UTSW 15 27,871,375 (GRCm39) missense possibly damaging 0.66
R7352:Trio UTSW 15 27,732,962 (GRCm39) missense probably damaging 0.96
R7426:Trio UTSW 15 27,856,193 (GRCm39) missense probably benign 0.01
R7451:Trio UTSW 15 27,747,999 (GRCm39) missense probably benign 0.07
R7558:Trio UTSW 15 27,831,480 (GRCm39) missense possibly damaging 0.90
R7578:Trio UTSW 15 27,855,025 (GRCm39) missense possibly damaging 0.94
R7596:Trio UTSW 15 27,749,912 (GRCm39) missense probably damaging 0.99
R7604:Trio UTSW 15 27,736,531 (GRCm39) critical splice donor site probably null
R7609:Trio UTSW 15 27,912,728 (GRCm39) missense unknown
R7767:Trio UTSW 15 27,889,504 (GRCm39) missense unknown
R7784:Trio UTSW 15 27,764,080 (GRCm39) missense probably damaging 1.00
R7817:Trio UTSW 15 27,749,952 (GRCm39) missense probably benign 0.35
R7833:Trio UTSW 15 27,774,172 (GRCm39) missense probably damaging 0.99
R7873:Trio UTSW 15 27,805,770 (GRCm39) missense possibly damaging 0.83
R7879:Trio UTSW 15 27,852,010 (GRCm39) missense possibly damaging 0.94
R7989:Trio UTSW 15 27,773,021 (GRCm39) missense probably damaging 0.97
R8022:Trio UTSW 15 27,749,952 (GRCm39) missense probably benign 0.35
R8050:Trio UTSW 15 27,891,540 (GRCm39) missense unknown
R8217:Trio UTSW 15 27,819,055 (GRCm39) missense probably damaging 0.97
R8280:Trio UTSW 15 27,902,996 (GRCm39) missense unknown
R8283:Trio UTSW 15 27,756,628 (GRCm39) missense possibly damaging 0.79
R8300:Trio UTSW 15 27,855,108 (GRCm39) missense possibly damaging 0.66
R8321:Trio UTSW 15 27,881,412 (GRCm39) missense possibly damaging 0.90
R8477:Trio UTSW 15 27,774,038 (GRCm39) missense possibly damaging 0.83
R8479:Trio UTSW 15 27,901,286 (GRCm39) missense probably benign 0.25
R8682:Trio UTSW 15 27,905,278 (GRCm39) missense unknown
R8688:Trio UTSW 15 27,748,324 (GRCm39) missense possibly damaging 0.61
R8708:Trio UTSW 15 27,732,632 (GRCm39) missense probably damaging 0.99
R8709:Trio UTSW 15 27,919,323 (GRCm39) missense unknown
R8713:Trio UTSW 15 27,744,037 (GRCm39) critical splice donor site probably benign
R8798:Trio UTSW 15 27,851,923 (GRCm39) missense possibly damaging 0.92
R8812:Trio UTSW 15 27,905,311 (GRCm39) missense unknown
R8816:Trio UTSW 15 27,741,357 (GRCm39) missense probably damaging 0.96
R8828:Trio UTSW 15 27,741,150 (GRCm39) missense possibly damaging 0.93
R8987:Trio UTSW 15 27,732,773 (GRCm39) missense probably benign 0.23
R9051:Trio UTSW 15 27,732,770 (GRCm39) missense possibly damaging 0.78
R9069:Trio UTSW 15 27,852,097 (GRCm39) missense possibly damaging 0.83
R9075:Trio UTSW 15 27,774,022 (GRCm39) nonsense probably null
R9079:Trio UTSW 15 27,733,023 (GRCm39) missense possibly damaging 0.52
R9139:Trio UTSW 15 27,749,922 (GRCm39) nonsense probably null
R9494:Trio UTSW 15 27,846,843 (GRCm39) missense probably benign 0.00
R9680:Trio UTSW 15 27,744,158 (GRCm39) missense possibly damaging 0.93
R9720:Trio UTSW 15 27,847,495 (GRCm39) missense probably benign 0.00
R9726:Trio UTSW 15 27,912,752 (GRCm39) missense unknown
X0024:Trio UTSW 15 27,765,812 (GRCm39) missense possibly damaging 0.91
Z1176:Trio UTSW 15 27,771,473 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACAGATATGTGTGCTGGCAC -3'
(R):5'- TGCCTGGAGCTAGGAATTAATTC -3'

Sequencing Primer
(F):5'- TGCTGGCACATGAAGCTC -3'
(R):5'- CCTGGAGCTAGGAATTAATTCATCAC -3'
Posted On 2018-05-04