Incidental Mutation 'R6387:Atp6v1a'
List |< first << previous [record 8 of 43] next >> last >|
ID514681
Institutional Source Beutler Lab
Gene Symbol Atp6v1a
Ensembl Gene ENSMUSG00000052459
Gene NameATPase, H+ transporting, lysosomal V1 subunit A
SynonymsAtp6a1, VA68, VPP2, lysosomal 70kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location44085402-44139705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44087443 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 612 (F612S)
Ref Sequence ENSEMBL: ENSMUSP00000110314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063661] [ENSMUST00000114666]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063661
AA Change: F612S

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000066886
Gene: ENSMUSG00000052459
AA Change: F612S

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 21 83 8.5e-16 PFAM
low complexity region 206 217 N/A INTRINSIC
Pfam:ATP-synt_ab 229 455 4.4e-113 PFAM
Pfam:ATP-synt_ab_C 473 617 2.4e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114666
AA Change: F612S

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110314
Gene: ENSMUSG00000052459
AA Change: F612S

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 21 83 2.4e-16 PFAM
Pfam:ATP-synt_ab_Xtn 99 221 3.3e-46 PFAM
Pfam:ATP-synt_ab 230 455 3.3e-110 PFAM
Pfam:ATP-synt_ab_C 473 617 2.4e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain A subunit isoforms and is found in all tissues. Transcript variants derived from alternative polyadenylation exist. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Atp6v1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Atp6v1a APN 16 44111583 missense probably benign 0.00
IGL01860:Atp6v1a APN 16 44099956 missense probably damaging 1.00
IGL02691:Atp6v1a APN 16 44111619 missense probably damaging 1.00
IGL03256:Atp6v1a APN 16 44111088 unclassified probably benign
IGL03307:Atp6v1a APN 16 44111559 missense possibly damaging 0.74
R0605:Atp6v1a UTSW 16 44111496 critical splice donor site probably null
R0696:Atp6v1a UTSW 16 44087471 missense probably benign
R0883:Atp6v1a UTSW 16 44101692 splice site probably benign
R1777:Atp6v1a UTSW 16 44114705 nonsense probably null
R2370:Atp6v1a UTSW 16 44107040 missense probably benign 0.10
R2932:Atp6v1a UTSW 16 44089043 missense probably benign 0.03
R3725:Atp6v1a UTSW 16 44101757 splice site probably benign
R4224:Atp6v1a UTSW 16 44101811 missense probably damaging 1.00
R5780:Atp6v1a UTSW 16 44114643 missense probably benign 0.01
R5945:Atp6v1a UTSW 16 44099946 missense probably damaging 0.99
R6032:Atp6v1a UTSW 16 44106940 missense probably damaging 1.00
R6032:Atp6v1a UTSW 16 44106940 missense probably damaging 1.00
R6036:Atp6v1a UTSW 16 44098831 missense probably benign 0.02
R6036:Atp6v1a UTSW 16 44098831 missense probably benign 0.02
R6479:Atp6v1a UTSW 16 44098758 missense probably benign 0.00
R6756:Atp6v1a UTSW 16 44089058 missense probably benign 0.18
R7313:Atp6v1a UTSW 16 44114617 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCTAGCTCCTTCAAACACTG -3'
(R):5'- AAATTGGGCTTACCTGCGATTTAC -3'

Sequencing Primer
(F):5'- CTTCAAACACTGGAACAAAGGAATG -3'
(R):5'- ACCTGCGATTTACCAGTTGATAC -3'
Posted On2018-05-04