Incidental Mutation 'R6387:Enpp5'
List |< first << previous [record 13 of 43] next >> last >|
ID514682
Institutional Source Beutler Lab
Gene Symbol Enpp5
Ensembl Gene ENSMUSG00000023960
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 5
SynonymsD17Abb1e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location44078813-44086567 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44085264 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 356 (G356S)
Ref Sequence ENSEMBL: ENSMUSP00000122767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024756] [ENSMUST00000126032] [ENSMUST00000154166]
Predicted Effect probably damaging
Transcript: ENSMUST00000024756
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024756
Gene: ENSMUSG00000023960
AA Change: G356S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 7.1e-91 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126032
Predicted Effect probably damaging
Transcript: ENSMUST00000154166
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122767
Gene: ENSMUSG00000023960
AA Change: G356S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 2.1e-86 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Meta Mutation Damage Score 0.9168 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I transmembrane glycoprotein. Studies in rat suggest the encoded protein may play a role in neuronal cell communications. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Pfas A G 11: 69,000,465 F269L probably damaging Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Enpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Enpp5 APN 17 44085197 splice site probably benign
IGL01593:Enpp5 APN 17 44080721 missense probably benign
IGL01654:Enpp5 APN 17 44081175 missense possibly damaging 0.82
IGL02120:Enpp5 APN 17 44080845 missense probably benign 0.04
IGL02142:Enpp5 APN 17 44085577 missense probably benign 0.01
IGL02531:Enpp5 APN 17 44080952 missense probably damaging 1.00
IGL02630:Enpp5 APN 17 44082875 missense probably damaging 1.00
Cacao UTSW 17 44085576 missense probably benign 0.00
canola UTSW 17 44085264 missense probably damaging 1.00
R1101:Enpp5 UTSW 17 44081367 missense possibly damaging 0.77
R2074:Enpp5 UTSW 17 44085373 missense probably benign 0.25
R2679:Enpp5 UTSW 17 44085388 missense probably damaging 1.00
R4739:Enpp5 UTSW 17 44081136 missense probably damaging 1.00
R4817:Enpp5 UTSW 17 44080980 makesense probably null
R5152:Enpp5 UTSW 17 44081133 missense probably damaging 1.00
R6021:Enpp5 UTSW 17 44085319 missense probably benign 0.22
R6160:Enpp5 UTSW 17 44081368 missense possibly damaging 0.77
R6330:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6385:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6452:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6454:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6461:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6462:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6463:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6469:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6470:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6471:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6473:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6505:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6563:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6564:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6760:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6812:Enpp5 UTSW 17 44085576 missense probably benign 0.00
R6821:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6824:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6963:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6965:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7169:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7171:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7375:Enpp5 UTSW 17 44080977 missense probably benign 0.02
R7393:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7394:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7411:Enpp5 UTSW 17 44081475 missense probably damaging 1.00
R7412:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7446:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7447:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7560:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7561:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7589:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7590:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7591:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTAAGAAAGACGGGTATC -3'
(R):5'- CTGGTTTGTCACTCCCAAGG -3'

Sequencing Primer
(F):5'- GACGGGTATCTAGGTAACATTTGAC -3'
(R):5'- CTCCCAAGGAGGAGTGTGGTAC -3'
Posted On2018-05-04