Incidental Mutation 'R6395:Smarcal1'
ID514688
Institutional Source Beutler Lab
Gene Symbol Smarcal1
Ensembl Gene ENSMUSG00000039354
Gene NameSWI/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1
Synonyms6030401P21Rik, Mharp
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6395 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location72583251-72633134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72616557 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 665 (E665V)
Ref Sequence ENSEMBL: ENSMUSP00000137833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047615] [ENSMUST00000152225]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047615
AA Change: E665V

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047589
Gene: ENSMUSG00000039354
AA Change: E665V

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 3.6e-26 PFAM
Pfam:HARP 302 356 1.2e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150725
Predicted Effect possibly damaging
Transcript: ENSMUST00000152225
AA Change: E665V

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137833
Gene: ENSMUSG00000039354
AA Change: E665V

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 8e-29 PFAM
Pfam:HARP 302 356 3e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein shows sequence similarity to the E. coli RNA polymerase-binding protein HepA. Mutations in this gene are a cause of Schimke immunoosseous dysplasia (SIOD), an autosomal recessive disorder with the diagnostic features of spondyloepiphyseal dysplasia, renal dysfunction, and T-cell immunodeficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display reduced B cell counts and increased susceptibility to heat induced mortality. Treatment of homozygous null mice with alpha-amanitin results in phenotypes similar to Schimke Type Immunoosseous Dysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,741,098 D68G probably benign Het
Actc1 C A 2: 114,049,250 E243* probably null Het
Ahi1 T C 10: 20,979,592 I600T possibly damaging Het
Apob A G 12: 8,008,507 T2330A probably benign Het
BC067074 T G 13: 113,369,469 C2377W probably damaging Het
Cabin1 A T 10: 75,746,742 M280K probably benign Het
Ccdc117 T C 11: 5,534,762 probably null Het
Cct8 G T 16: 87,486,476 Y292* probably null Het
Celf1 A G 2: 91,003,858 I165V probably benign Het
Cenpc1 A T 5: 86,035,570 N453K probably benign Het
Chst10 T C 1: 38,871,689 I131M probably damaging Het
Cltc A G 11: 86,725,180 I420T probably damaging Het
Dact3 A C 7: 16,883,161 Q95P probably damaging Het
Dennd2c T C 3: 103,149,224 probably null Het
Dock2 G T 11: 34,232,874 H1586Q probably damaging Het
Dst T C 1: 34,182,690 M2525T probably benign Het
Egflam T C 15: 7,231,695 H786R probably damaging Het
Eml6 T C 11: 29,809,321 T811A probably benign Het
Epha1 T C 6: 42,366,172 T148A probably damaging Het
Fsip1 A C 2: 118,236,925 S306A probably damaging Het
Gga2 A T 7: 122,008,438 probably null Het
Gm10801 C CGTT 2: 98,663,807 probably benign Het
Gm12800 G A 4: 101,909,992 R146H probably benign Het
Gm5724 T A 6: 141,723,092 probably null Het
Gm9837 T A 11: 53,470,058 probably benign Het
Gnl2 A T 4: 125,046,265 Q310L probably damaging Het
H2-M1 T C 17: 36,671,809 D53G probably benign Het
Hmcn2 T A 2: 31,369,257 D1036E probably damaging Het
Htr3a A T 9: 48,900,571 D381E probably benign Het
Igdcc4 G A 9: 65,135,118 G106R probably damaging Het
Igfbp2 A G 1: 72,824,919 T114A probably damaging Het
Ints14 A G 9: 64,978,124 probably null Het
Kcnt1 T A 2: 25,909,239 M906K possibly damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lars2 A G 9: 123,371,925 Q18R probably benign Het
Mndal C T 1: 173,871,433 C222Y possibly damaging Het
Msto1 C T 3: 88,905,474 A1854V possibly damaging Het
Musk G A 4: 58,286,169 G20R probably benign Het
Olfr811 G T 10: 129,802,144 P127Q probably damaging Het
Oxct1 G T 15: 4,026,827 S19I possibly damaging Het
Papss2 G A 19: 32,664,476 G517D probably damaging Het
Parp14 T C 16: 35,856,548 S1017G probably benign Het
Pde2a A G 7: 101,501,035 Q227R probably benign Het
Pdlim5 G T 3: 142,314,422 P92Q probably damaging Het
Pkd1l3 C T 8: 109,623,963 T480I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Ppp3ca A G 3: 136,877,770 R213G possibly damaging Het
Prrc1 C T 18: 57,362,547 S32L probably null Het
Prss47 C T 13: 65,049,302 V207I probably benign Het
Prtg G A 9: 72,912,132 V1136I possibly damaging Het
Psmb8 T A 17: 34,199,291 M69K possibly damaging Het
Rb1 A T 14: 73,199,196 D876E probably damaging Het
Rnasel T C 1: 153,762,121 M680T probably damaging Het
Rnf111 G T 9: 70,476,410 N80K possibly damaging Het
Senp1 C T 15: 98,048,193 C557Y probably damaging Het
Serpina3a A T 12: 104,116,451 Y161F probably damaging Het
Serpinb11 A T 1: 107,372,051 probably null Het
Sgpl1 C A 10: 61,112,157 probably null Het
Slc37a4 A G 9: 44,399,279 Y60C probably damaging Het
Slc38a10 A G 11: 120,124,382 S381P probably benign Het
Slc5a7 C T 17: 54,278,821 V323I probably damaging Het
Specc1 C A 11: 62,132,338 N736K probably damaging Het
Tas2r121 T C 6: 132,700,532 Y159C probably benign Het
Trank1 A G 9: 111,367,200 I1431V probably damaging Het
Ttll6 T C 11: 96,156,588 V671A probably benign Het
Ttn A T 2: 76,918,587 probably benign Het
Uimc1 T C 13: 55,040,576 T557A possibly damaging Het
Uri1 C A 7: 37,962,549 V446L probably benign Het
Vpreb2 C T 16: 17,980,907 R86C probably damaging Het
Vwa8 A G 14: 79,093,744 K1231E probably benign Het
Xcr1 G A 9: 123,855,789 R303C probably damaging Het
Zfp619 C A 7: 39,537,030 A828E possibly damaging Het
Zfp687 T C 3: 95,007,738 S1151G possibly damaging Het
Other mutations in Smarcal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Smarcal1 APN 1 72616565 missense possibly damaging 0.80
IGL01658:Smarcal1 APN 1 72586131 missense probably benign 0.00
IGL01980:Smarcal1 APN 1 72616520 nonsense probably null
IGL02007:Smarcal1 APN 1 72595940 missense probably damaging 0.98
IGL02153:Smarcal1 APN 1 72633055 utr 3 prime probably benign
IGL02496:Smarcal1 APN 1 72620088 missense probably damaging 1.00
IGL03084:Smarcal1 APN 1 72598935 splice site probably null
IGL03135:Smarcal1 APN 1 72616501 splice site probably null
IGL03306:Smarcal1 APN 1 72626466 missense probably benign 0.12
R0133:Smarcal1 UTSW 1 72632851 missense probably benign 0.05
R0315:Smarcal1 UTSW 1 72595811 nonsense probably null
R0396:Smarcal1 UTSW 1 72626473 missense probably benign 0.03
R0891:Smarcal1 UTSW 1 72598856 missense probably damaging 0.99
R1799:Smarcal1 UTSW 1 72585961 missense probably damaging 0.97
R1854:Smarcal1 UTSW 1 72586099 missense possibly damaging 0.77
R3725:Smarcal1 UTSW 1 72626596 missense possibly damaging 0.88
R3726:Smarcal1 UTSW 1 72626596 missense possibly damaging 0.88
R4164:Smarcal1 UTSW 1 72626689 intron probably benign
R4438:Smarcal1 UTSW 1 72611478 intron probably benign
R4722:Smarcal1 UTSW 1 72611337 missense probably damaging 1.00
R4796:Smarcal1 UTSW 1 72597440 missense probably benign
R4989:Smarcal1 UTSW 1 72632860 missense possibly damaging 0.84
R5242:Smarcal1 UTSW 1 72591083 missense probably benign 0.00
R5367:Smarcal1 UTSW 1 72595976 critical splice donor site probably null
R5418:Smarcal1 UTSW 1 72598909 missense probably benign 0.01
R5430:Smarcal1 UTSW 1 72626617 missense probably damaging 1.00
R5591:Smarcal1 UTSW 1 72591253 missense probably damaging 1.00
R5607:Smarcal1 UTSW 1 72586213 missense probably benign 0.00
R5809:Smarcal1 UTSW 1 72591137 missense probably benign 0.09
R6447:Smarcal1 UTSW 1 72585874 missense probably damaging 0.96
R6852:Smarcal1 UTSW 1 72591173 missense possibly damaging 0.75
R7060:Smarcal1 UTSW 1 72612942 missense probably damaging 1.00
R7692:Smarcal1 UTSW 1 72586020 missense probably benign 0.08
R7975:Smarcal1 UTSW 1 72612991 missense probably benign 0.08
R8232:Smarcal1 UTSW 1 72626563 missense probably damaging 1.00
R8407:Smarcal1 UTSW 1 72601395 missense probably benign 0.04
Z1177:Smarcal1 UTSW 1 72591267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGATGTTTTGAAATGTACCAGAC -3'
(R):5'- TCAACAGCAGTGAGGTTGTAC -3'

Sequencing Primer
(F):5'- ATGTACCAGACTAGAGTAGTTGC -3'
(R):5'- GGCAACATCAGGCATCTTCCTTAG -3'
Posted On2018-05-04