Incidental Mutation 'R6395:Rnasel'
ID514691
Institutional Source Beutler Lab
Gene Symbol Rnasel
Ensembl Gene ENSMUSG00000066800
Gene Nameribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)
Synonyms2-5A-dependent RNAase, E230029I04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6395 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location153749426-153764221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153762121 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 680 (M680T)
Ref Sequence ENSEMBL: ENSMUSP00000083385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086209] [ENSMUST00000182538] [ENSMUST00000182722] [ENSMUST00000183241]
Predicted Effect probably damaging
Transcript: ENSMUST00000086209
AA Change: M680T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083385
Gene: ENSMUSG00000066800
AA Change: M680T

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase 365 521 4.9e-19 PFAM
Pfam:Pkinase_Tyr 365 523 6.1e-14 PFAM
Pfam:Kdo 451 546 8e-8 PFAM
PUG 656 707 2.33e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182131
Predicted Effect possibly damaging
Transcript: ENSMUST00000182538
AA Change: M172T

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138734
Gene: ENSMUSG00000066800
AA Change: M172T

DomainStartEndE-ValueType
PUG 148 199 2.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182722
SMART Domains Protein: ENSMUSP00000138247
Gene: ENSMUSG00000066800

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase_Tyr 364 523 2.4e-13 PFAM
Pfam:Pkinase 365 520 2.1e-18 PFAM
Pfam:Kdo 452 546 9.3e-7 PFAM
Pfam:Ribonuc_2-5A 589 651 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183241
SMART Domains Protein: ENSMUSP00000138752
Gene: ENSMUSG00000066800

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase_Tyr 364 523 2.6e-13 PFAM
Pfam:Pkinase 365 517 2.4e-18 PFAM
Pfam:Kdo 452 546 9.7e-7 PFAM
Pfam:Ribonuc_2-5A 589 674 1.7e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the interferon-regulated 2-5A system that functions in the antiviral and antiproliferative roles of interferons. Mutations in this gene have been associated with predisposition to prostate cancer and this gene is a candidate for the hereditary prostate cancer 1 (HPC1) allele. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an enlarged spleen and increased succeptibility to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,741,098 D68G probably benign Het
Actc1 C A 2: 114,049,250 E243* probably null Het
Ahi1 T C 10: 20,979,592 I600T possibly damaging Het
Apob A G 12: 8,008,507 T2330A probably benign Het
BC067074 T G 13: 113,369,469 C2377W probably damaging Het
Cabin1 A T 10: 75,746,742 M280K probably benign Het
Ccdc117 T C 11: 5,534,762 probably null Het
Cct8 G T 16: 87,486,476 Y292* probably null Het
Celf1 A G 2: 91,003,858 I165V probably benign Het
Cenpc1 A T 5: 86,035,570 N453K probably benign Het
Chst10 T C 1: 38,871,689 I131M probably damaging Het
Cltc A G 11: 86,725,180 I420T probably damaging Het
Dact3 A C 7: 16,883,161 Q95P probably damaging Het
Dennd2c T C 3: 103,149,224 probably null Het
Dock2 G T 11: 34,232,874 H1586Q probably damaging Het
Dst T C 1: 34,182,690 M2525T probably benign Het
Egflam T C 15: 7,231,695 H786R probably damaging Het
Eml6 T C 11: 29,809,321 T811A probably benign Het
Epha1 T C 6: 42,366,172 T148A probably damaging Het
Fsip1 A C 2: 118,236,925 S306A probably damaging Het
Gga2 A T 7: 122,008,438 probably null Het
Gm10801 C CGTT 2: 98,663,807 probably benign Het
Gm12800 G A 4: 101,909,992 R146H probably benign Het
Gm5724 T A 6: 141,723,092 probably null Het
Gm9837 T A 11: 53,470,058 probably benign Het
Gnl2 A T 4: 125,046,265 Q310L probably damaging Het
H2-M1 T C 17: 36,671,809 D53G probably benign Het
Hmcn2 T A 2: 31,369,257 D1036E probably damaging Het
Htr3a A T 9: 48,900,571 D381E probably benign Het
Igdcc4 G A 9: 65,135,118 G106R probably damaging Het
Igfbp2 A G 1: 72,824,919 T114A probably damaging Het
Ints14 A G 9: 64,978,124 probably null Het
Kcnt1 T A 2: 25,909,239 M906K possibly damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lars2 A G 9: 123,371,925 Q18R probably benign Het
Mndal C T 1: 173,871,433 C222Y possibly damaging Het
Msto1 C T 3: 88,905,474 A1854V possibly damaging Het
Musk G A 4: 58,286,169 G20R probably benign Het
Olfr811 G T 10: 129,802,144 P127Q probably damaging Het
Oxct1 G T 15: 4,026,827 S19I possibly damaging Het
Papss2 G A 19: 32,664,476 G517D probably damaging Het
Parp14 T C 16: 35,856,548 S1017G probably benign Het
Pde2a A G 7: 101,501,035 Q227R probably benign Het
Pdlim5 G T 3: 142,314,422 P92Q probably damaging Het
Pkd1l3 C T 8: 109,623,963 T480I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Ppp3ca A G 3: 136,877,770 R213G possibly damaging Het
Prrc1 C T 18: 57,362,547 S32L probably null Het
Prss47 C T 13: 65,049,302 V207I probably benign Het
Prtg G A 9: 72,912,132 V1136I possibly damaging Het
Psmb8 T A 17: 34,199,291 M69K possibly damaging Het
Rb1 A T 14: 73,199,196 D876E probably damaging Het
Rnf111 G T 9: 70,476,410 N80K possibly damaging Het
Senp1 C T 15: 98,048,193 C557Y probably damaging Het
Serpina3a A T 12: 104,116,451 Y161F probably damaging Het
Serpinb11 A T 1: 107,372,051 probably null Het
Sgpl1 C A 10: 61,112,157 probably null Het
Slc37a4 A G 9: 44,399,279 Y60C probably damaging Het
Slc38a10 A G 11: 120,124,382 S381P probably benign Het
Slc5a7 C T 17: 54,278,821 V323I probably damaging Het
Smarcal1 A T 1: 72,616,557 E665V possibly damaging Het
Specc1 C A 11: 62,132,338 N736K probably damaging Het
Tas2r121 T C 6: 132,700,532 Y159C probably benign Het
Trank1 A G 9: 111,367,200 I1431V probably damaging Het
Ttll6 T C 11: 96,156,588 V671A probably benign Het
Ttn A T 2: 76,918,587 probably benign Het
Uimc1 T C 13: 55,040,576 T557A possibly damaging Het
Uri1 C A 7: 37,962,549 V446L probably benign Het
Vpreb2 C T 16: 17,980,907 R86C probably damaging Het
Vwa8 A G 14: 79,093,744 K1231E probably benign Het
Xcr1 G A 9: 123,855,789 R303C probably damaging Het
Zfp619 C A 7: 39,537,030 A828E possibly damaging Het
Zfp687 T C 3: 95,007,738 S1151G possibly damaging Het
Other mutations in Rnasel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Rnasel APN 1 153758384 missense probably benign 0.04
IGL02662:Rnasel APN 1 153754111 missense probably damaging 1.00
IGL03215:Rnasel APN 1 153758555 missense probably damaging 1.00
R0022:Rnasel UTSW 1 153760775 missense probably damaging 1.00
R0022:Rnasel UTSW 1 153760775 missense probably damaging 1.00
R0028:Rnasel UTSW 1 153754719 missense probably benign 0.04
R0116:Rnasel UTSW 1 153754512 missense probably damaging 1.00
R0981:Rnasel UTSW 1 153759599 missense probably benign 0.03
R1523:Rnasel UTSW 1 153756013 missense probably damaging 0.98
R1538:Rnasel UTSW 1 153760794 missense possibly damaging 0.62
R1646:Rnasel UTSW 1 153755054 missense probably damaging 1.00
R1793:Rnasel UTSW 1 153754423 missense probably damaging 0.98
R1843:Rnasel UTSW 1 153754674 missense possibly damaging 0.94
R2158:Rnasel UTSW 1 153754901 missense probably damaging 1.00
R2434:Rnasel UTSW 1 153754650 missense probably damaging 1.00
R2895:Rnasel UTSW 1 153760776 missense probably damaging 1.00
R4107:Rnasel UTSW 1 153754796 missense probably benign 0.00
R5013:Rnasel UTSW 1 153753931 missense probably damaging 0.99
R5015:Rnasel UTSW 1 153754097 nonsense probably null
R5540:Rnasel UTSW 1 153755144 nonsense probably null
R5688:Rnasel UTSW 1 153753706 start gained probably benign
R5955:Rnasel UTSW 1 153754400 missense probably benign 0.05
R6131:Rnasel UTSW 1 153754460 missense probably damaging 1.00
R6164:Rnasel UTSW 1 153754392 missense probably benign 0.32
R6483:Rnasel UTSW 1 153754686 missense probably benign 0.10
R7470:Rnasel UTSW 1 153754031 missense probably benign 0.00
R7538:Rnasel UTSW 1 153754560 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTAGGGATAGGGCCATGTG -3'
(R):5'- AAGACTCAGCTCTGTATGCC -3'

Sequencing Primer
(F):5'- ATAGGGCCATGTGAGGGTC -3'
(R):5'- AGCTCTGTATGCCCCCTGG -3'
Posted On2018-05-04