Incidental Mutation 'R6395:Pla2g4c'
ID514712
Institutional Source Beutler Lab
Gene Symbol Pla2g4c
Ensembl Gene ENSMUSG00000033847
Gene Namephospholipase A2, group IVC (cytosolic, calcium-independent)
SynonymsCPLA2-gamma
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6395 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location13324655-13360672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13344008 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 357 (T357I)
Ref Sequence ENSEMBL: ENSMUSP00000043672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043612] [ENSMUST00000108528] [ENSMUST00000167232]
Predicted Effect probably benign
Transcript: ENSMUST00000043612
AA Change: T357I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000043672
Gene: ENSMUSG00000033847
AA Change: T357I

DomainStartEndE-ValueType
PLAc 1 534 1.97e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108528
AA Change: T367I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104168
Gene: ENSMUSG00000033847
AA Change: T367I

DomainStartEndE-ValueType
PLAc 1 544 1.23e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157290
Predicted Effect probably benign
Transcript: ENSMUST00000167232
AA Change: T367I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000127060
Gene: ENSMUSG00000033847
AA Change: T367I

DomainStartEndE-ValueType
PLAc 1 544 1.23e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the phospholipase A2 enzyme family which hydrolyzes glycerophospholipids to produce free fatty acids and lysophospholipids, both of which serve as precursors in the production of signaling molecules. The encoded protein has been shown to be a calcium-independent and membrane bound enzyme. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,741,098 D68G probably benign Het
Actc1 C A 2: 114,049,250 E243* probably null Het
Ahi1 T C 10: 20,979,592 I600T possibly damaging Het
Apob A G 12: 8,008,507 T2330A probably benign Het
BC067074 T G 13: 113,369,469 C2377W probably damaging Het
Cabin1 A T 10: 75,746,742 M280K probably benign Het
Ccdc117 T C 11: 5,534,762 probably null Het
Cct8 G T 16: 87,486,476 Y292* probably null Het
Celf1 A G 2: 91,003,858 I165V probably benign Het
Cenpc1 A T 5: 86,035,570 N453K probably benign Het
Chst10 T C 1: 38,871,689 I131M probably damaging Het
Cltc A G 11: 86,725,180 I420T probably damaging Het
Dact3 A C 7: 16,883,161 Q95P probably damaging Het
Dennd2c T C 3: 103,149,224 probably null Het
Dock2 G T 11: 34,232,874 H1586Q probably damaging Het
Dst T C 1: 34,182,690 M2525T probably benign Het
Egflam T C 15: 7,231,695 H786R probably damaging Het
Eml6 T C 11: 29,809,321 T811A probably benign Het
Epha1 T C 6: 42,366,172 T148A probably damaging Het
Fsip1 A C 2: 118,236,925 S306A probably damaging Het
Gga2 A T 7: 122,008,438 probably null Het
Gm10801 C CGTT 2: 98,663,807 probably benign Het
Gm12800 G A 4: 101,909,992 R146H probably benign Het
Gm5724 T A 6: 141,723,092 probably null Het
Gm9837 T A 11: 53,470,058 probably benign Het
Gnl2 A T 4: 125,046,265 Q310L probably damaging Het
H2-M1 T C 17: 36,671,809 D53G probably benign Het
Hmcn2 T A 2: 31,369,257 D1036E probably damaging Het
Htr3a A T 9: 48,900,571 D381E probably benign Het
Igdcc4 G A 9: 65,135,118 G106R probably damaging Het
Igfbp2 A G 1: 72,824,919 T114A probably damaging Het
Ints14 A G 9: 64,978,124 probably null Het
Kcnt1 T A 2: 25,909,239 M906K possibly damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lars2 A G 9: 123,371,925 Q18R probably benign Het
Mndal C T 1: 173,871,433 C222Y possibly damaging Het
Msto1 C T 3: 88,905,474 A1854V possibly damaging Het
Musk G A 4: 58,286,169 G20R probably benign Het
Olfr811 G T 10: 129,802,144 P127Q probably damaging Het
Oxct1 G T 15: 4,026,827 S19I possibly damaging Het
Papss2 G A 19: 32,664,476 G517D probably damaging Het
Parp14 T C 16: 35,856,548 S1017G probably benign Het
Pde2a A G 7: 101,501,035 Q227R probably benign Het
Pdlim5 G T 3: 142,314,422 P92Q probably damaging Het
Pkd1l3 C T 8: 109,623,963 T480I probably benign Het
Ppp3ca A G 3: 136,877,770 R213G possibly damaging Het
Prrc1 C T 18: 57,362,547 S32L probably null Het
Prss47 C T 13: 65,049,302 V207I probably benign Het
Prtg G A 9: 72,912,132 V1136I possibly damaging Het
Psmb8 T A 17: 34,199,291 M69K possibly damaging Het
Rb1 A T 14: 73,199,196 D876E probably damaging Het
Rnasel T C 1: 153,762,121 M680T probably damaging Het
Rnf111 G T 9: 70,476,410 N80K possibly damaging Het
Senp1 C T 15: 98,048,193 C557Y probably damaging Het
Serpina3a A T 12: 104,116,451 Y161F probably damaging Het
Serpinb11 A T 1: 107,372,051 probably null Het
Sgpl1 C A 10: 61,112,157 probably null Het
Slc37a4 A G 9: 44,399,279 Y60C probably damaging Het
Slc38a10 A G 11: 120,124,382 S381P probably benign Het
Slc5a7 C T 17: 54,278,821 V323I probably damaging Het
Smarcal1 A T 1: 72,616,557 E665V possibly damaging Het
Specc1 C A 11: 62,132,338 N736K probably damaging Het
Tas2r121 T C 6: 132,700,532 Y159C probably benign Het
Trank1 A G 9: 111,367,200 I1431V probably damaging Het
Ttll6 T C 11: 96,156,588 V671A probably benign Het
Ttn A T 2: 76,918,587 probably benign Het
Uimc1 T C 13: 55,040,576 T557A possibly damaging Het
Uri1 C A 7: 37,962,549 V446L probably benign Het
Vpreb2 C T 16: 17,980,907 R86C probably damaging Het
Vwa8 A G 14: 79,093,744 K1231E probably benign Het
Xcr1 G A 9: 123,855,789 R303C probably damaging Het
Zfp619 C A 7: 39,537,030 A828E possibly damaging Het
Zfp687 T C 3: 95,007,738 S1151G possibly damaging Het
Other mutations in Pla2g4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Pla2g4c APN 7 13344026 missense probably benign 0.01
IGL00972:Pla2g4c APN 7 13340658 missense probably benign 0.13
IGL01759:Pla2g4c APN 7 13348316 missense probably damaging 1.00
IGL02567:Pla2g4c APN 7 13346040 missense probably damaging 1.00
IGL02629:Pla2g4c APN 7 13335377 nonsense probably null
IGL02719:Pla2g4c APN 7 13330094 missense probably damaging 1.00
IGL02812:Pla2g4c APN 7 13348365 missense probably damaging 1.00
PIT4142001:Pla2g4c UTSW 7 13343391 missense probably benign
R0184:Pla2g4c UTSW 7 13356220 missense probably benign 0.16
R1052:Pla2g4c UTSW 7 13343409 missense possibly damaging 0.95
R1747:Pla2g4c UTSW 7 13337730 splice site probably benign
R4381:Pla2g4c UTSW 7 13346065 missense probably damaging 1.00
R4486:Pla2g4c UTSW 7 13337751 missense probably benign 0.09
R4674:Pla2g4c UTSW 7 13343514 missense probably null 0.24
R4811:Pla2g4c UTSW 7 13337813 missense probably damaging 1.00
R5655:Pla2g4c UTSW 7 13329964 splice site probably null
R5791:Pla2g4c UTSW 7 13339692 missense probably benign 0.32
R5814:Pla2g4c UTSW 7 13340618 missense probably damaging 1.00
R6381:Pla2g4c UTSW 7 13344008 missense probably benign 0.05
R6974:Pla2g4c UTSW 7 13344534 critical splice donor site probably null
R7257:Pla2g4c UTSW 7 13325744 missense possibly damaging 0.46
R7823:Pla2g4c UTSW 7 13330019 missense probably damaging 1.00
R8385:Pla2g4c UTSW 7 13329664 missense probably benign 0.00
Z1088:Pla2g4c UTSW 7 13329753 missense probably benign 0.13
Z1177:Pla2g4c UTSW 7 13348327 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAGGGGTAGGTACATGTCTGTC -3'
(R):5'- GACAGGCATTCTCTCTATTGTGTC -3'

Sequencing Primer
(F):5'- AGGTACATGTCTGTCCTGAGCAG -3'
(R):5'- CACACTCCTTCTGCTAGAGC -3'
Posted On2018-05-04