Mutagenetix > Incidental Mutations

Incidental Mutation 'R6395:Uri1'

514714

Institutional Source

Beutler Lab

Gene Symbol

Uri1

Ensembl Gene

ENSMUSG00000030421

Gene Name

URI1, prefoldin-like chaperone

Synonyms

NNX3, Rmp, C80913

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6395 (G1)

Quality Score

219.009

Status

Not validated

Chromosome

Chromosomal Location

37959992-38023551 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 37962549 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 446 (V446L)

Ref Sequence

ENSEMBL: ENSMUSP00000145738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085513] [ENSMUST00000206581]

Predicted Effect

probably benign
Transcript: ENSMUST00000085513
AA Change: V444L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000082646
Gene: ENSMUSG00000030421
AA Change: V444L

Domain	Start	End	E-Value	Type
low complexity region	2	27	N/A	INTRINSIC
Pfam:Prefoldin	35	150	3.3e-18	PFAM
Pfam:Prefoldin_3	43	141	5.2e-12	PFAM
low complexity region	207	226	N/A	INTRINSIC
SCOP:d1qbkb_	299	321	7e-3	SMART
low complexity region	358	368	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205809

Predicted Effect

probably benign
Transcript: ENSMUST00000205918

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205927

Predicted Effect

unknown
Transcript: ENSMUST00000206327
AA Change: V438L

Predicted Effect

probably benign
Transcript: ENSMUST00000206581
AA Change: V446L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.6%
20x: 98.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes member of the prefoldin family of molecular chaperones. The encoded protein functions as a scaffolding protein and plays roles in ubiquitination and transcription, in part though interactions with the RNA polymerase II subunit RPB5. This gene may play a role in multiple malignancies including ovarian cancer and hepatocellular carcinoma. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 22. [provided by RefSeq, Nov 2011]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700092M07Rik	A	G	19: 8,741,098	D68G	probably benign	Het
Actc1	C	A	2: 114,049,250	E243*	probably null	Het
Ahi1	T	C	10: 20,979,592	I600T	possibly damaging	Het
Apob	A	G	12: 8,008,507	T2330A	probably benign	Het
BC067074	T	G	13: 113,369,469	C2377W	probably damaging	Het
Cabin1	A	T	10: 75,746,742	M280K	probably benign	Het
Ccdc117	T	C	11: 5,534,762		probably null	Het
Cct8	G	T	16: 87,486,476	Y292*	probably null	Het
Celf1	A	G	2: 91,003,858	I165V	probably benign	Het
Cenpc1	A	T	5: 86,035,570	N453K	probably benign	Het
Chst10	T	C	1: 38,871,689	I131M	probably damaging	Het
Cltc	A	G	11: 86,725,180	I420T	probably damaging	Het
Dact3	A	C	7: 16,883,161	Q95P	probably damaging	Het
Dennd2c	T	C	3: 103,149,224		probably null	Het
Dock2	G	T	11: 34,232,874	H1586Q	probably damaging	Het
Dst	T	C	1: 34,182,690	M2525T	probably benign	Het
Egflam	T	C	15: 7,231,695	H786R	probably damaging	Het
Eml6	T	C	11: 29,809,321	T811A	probably benign	Het
Epha1	T	C	6: 42,366,172	T148A	probably damaging	Het
Fsip1	A	C	2: 118,236,925	S306A	probably damaging	Het
Gga2	A	T	7: 122,008,438		probably null	Het
Gm10801	C	CGTT	2: 98,663,807		probably benign	Het
Gm12800	G	A	4: 101,909,992	R146H	probably benign	Het
Gm5724	T	A	6: 141,723,092		probably null	Het
Gm9837	T	A	11: 53,470,058		probably benign	Het
Gnl2	A	T	4: 125,046,265	Q310L	probably damaging	Het
H2-M1	T	C	17: 36,671,809	D53G	probably benign	Het
Hmcn2	T	A	2: 31,369,257	D1036E	probably damaging	Het
Htr3a	A	T	9: 48,900,571	D381E	probably benign	Het
Igdcc4	G	A	9: 65,135,118	G106R	probably damaging	Het
Igfbp2	A	G	1: 72,824,919	T114A	probably damaging	Het
Ints14	A	G	9: 64,978,124		probably null	Het
Kcnt1	T	A	2: 25,909,239	M906K	possibly damaging	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Lars2	A	G	9: 123,371,925	Q18R	probably benign	Het
Mndal	C	T	1: 173,871,433	C222Y	possibly damaging	Het
Msto1	C	T	3: 88,905,474	A1854V	possibly damaging	Het
Musk	G	A	4: 58,286,169	G20R	probably benign	Het
Olfr811	G	T	10: 129,802,144	P127Q	probably damaging	Het
Oxct1	G	T	15: 4,026,827	S19I	possibly damaging	Het
Papss2	G	A	19: 32,664,476	G517D	probably damaging	Het
Parp14	T	C	16: 35,856,548	S1017G	probably benign	Het
Pde2a	A	G	7: 101,501,035	Q227R	probably benign	Het
Pdlim5	G	T	3: 142,314,422	P92Q	probably damaging	Het
Pkd1l3	C	T	8: 109,623,963	T480I	probably benign	Het
Pla2g4c	C	T	7: 13,344,008	T357I	probably benign	Het
Ppp3ca	A	G	3: 136,877,770	R213G	possibly damaging	Het
Prrc1	C	T	18: 57,362,547	S32L	probably null	Het
Prss47	C	T	13: 65,049,302	V207I	probably benign	Het
Prtg	G	A	9: 72,912,132	V1136I	possibly damaging	Het
Psmb8	T	A	17: 34,199,291	M69K	possibly damaging	Het
Rb1	A	T	14: 73,199,196	D876E	probably damaging	Het
Rnasel	T	C	1: 153,762,121	M680T	probably damaging	Het
Rnf111	G	T	9: 70,476,410	N80K	possibly damaging	Het
Senp1	C	T	15: 98,048,193	C557Y	probably damaging	Het
Serpina3a	A	T	12: 104,116,451	Y161F	probably damaging	Het
Serpinb11	A	T	1: 107,372,051		probably null	Het
Sgpl1	C	A	10: 61,112,157		probably null	Het
Slc37a4	A	G	9: 44,399,279	Y60C	probably damaging	Het
Slc38a10	A	G	11: 120,124,382	S381P	probably benign	Het
Slc5a7	C	T	17: 54,278,821	V323I	probably damaging	Het
Smarcal1	A	T	1: 72,616,557	E665V	possibly damaging	Het
Specc1	C	A	11: 62,132,338	N736K	probably damaging	Het
Tas2r121	T	C	6: 132,700,532	Y159C	probably benign	Het
Trank1	A	G	9: 111,367,200	I1431V	probably damaging	Het
Ttll6	T	C	11: 96,156,588	V671A	probably benign	Het
Ttn	A	T	2: 76,918,587		probably benign	Het
Uimc1	T	C	13: 55,040,576	T557A	possibly damaging	Het
Vpreb2	C	T	16: 17,980,907	R86C	probably damaging	Het
Vwa8	A	G	14: 79,093,744	K1231E	probably benign	Het
Xcr1	G	A	9: 123,855,789	R303C	probably damaging	Het
Zfp619	C	A	7: 39,537,030	A828E	possibly damaging	Het
Zfp687	T	C	3: 95,007,738	S1151G	possibly damaging	Het

Other mutations in Uri1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Uri1	APN	7	37961553	missense	probably damaging	1.00
IGL00978:Uri1	APN	7	37996731	splice site	probably benign
IGL01921:Uri1	APN	7	37981647	nonsense	probably null
IGL02538:Uri1	APN	7	37965491	missense	probably benign
IGL02750:Uri1	APN	7	37967481	nonsense	probably null
R0677:Uri1	UTSW	7	37965500	missense	probably benign	0.01
R0863:Uri1	UTSW	7	37969675	missense	probably damaging	0.98
R0945:Uri1	UTSW	7	37969678	missense	probably damaging	0.98
R1582:Uri1	UTSW	7	37965386	missense	possibly damaging	0.93
R1700:Uri1	UTSW	7	37963524	missense	probably damaging	1.00
R1793:Uri1	UTSW	7	37981691	missense	probably damaging	1.00
R1839:Uri1	UTSW	7	37967389	missense	probably benign	0.19
R1915:Uri1	UTSW	7	37961678	missense	probably damaging	0.98
R3967:Uri1	UTSW	7	37965502	missense	possibly damaging	0.85
R5609:Uri1	UTSW	7	37963529	nonsense	probably null
R6022:Uri1	UTSW	7	37961477	utr 3 prime	probably benign
R6873:Uri1	UTSW	7	37965339	missense	probably benign	0.00
R7602:Uri1	UTSW	7	37981628	missense	probably benign	0.14
R8108:Uri1	UTSW	7	37981673	missense	possibly damaging	0.91
R8765:Uri1	UTSW	7	37996720	missense	probably benign	0.18
Z1177:Uri1	UTSW	7	37981610	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AACTACCTAGTATTTGGACCGTC -3'
(R):5'- CAGTTACAAGCCCTTAAAATGGAG -3'

Sequencing Primer
(F):5'- AGTATTTGGACCGTCTCCCC -3'
(R):5'- GTTCCTCGCAAGTCAATC -3'

Posted On

2018-05-04