Incidental Mutation 'R6395:Htr3a'
ID514720
Institutional Source Beutler Lab
Gene Symbol Htr3a
Ensembl Gene ENSMUSG00000032269
Gene Name5-hydroxytryptamine (serotonin) receptor 3A
Synonyms5-HT3 receptor
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6395 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location48899213-48911099 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48900571 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 381 (D381E)
Ref Sequence ENSEMBL: ENSMUSP00000150647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003826] [ENSMUST00000217289]
Predicted Effect probably benign
Transcript: ENSMUST00000003826
AA Change: D381E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000003826
Gene: ENSMUSG00000032269
AA Change: D381E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:Neur_chan_LBD 40 247 4.7e-57 PFAM
Pfam:Neur_chan_memb 254 480 1.8e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216896
Predicted Effect probably benign
Transcript: ENSMUST00000217289
AA Change: D381E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit A of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It appears that the heteromeric combination of A and B subunits is necessary to provide the full functional features of this receptor, since either subunit alone results in receptors with very low conductance and response amplitude. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display a decreased lifespan, cachexia, increased blood urea nitrogen, proteinuria, kidney inflammation, and a hyperdistended and neurogenic urinary bladder. Mice homozygous for a second null mutation display reduced chemical pain persistence responses but are otherwise healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,741,098 D68G probably benign Het
Actc1 C A 2: 114,049,250 E243* probably null Het
Ahi1 T C 10: 20,979,592 I600T possibly damaging Het
Apob A G 12: 8,008,507 T2330A probably benign Het
BC067074 T G 13: 113,369,469 C2377W probably damaging Het
Cabin1 A T 10: 75,746,742 M280K probably benign Het
Ccdc117 T C 11: 5,534,762 probably null Het
Cct8 G T 16: 87,486,476 Y292* probably null Het
Celf1 A G 2: 91,003,858 I165V probably benign Het
Cenpc1 A T 5: 86,035,570 N453K probably benign Het
Chst10 T C 1: 38,871,689 I131M probably damaging Het
Cltc A G 11: 86,725,180 I420T probably damaging Het
Dact3 A C 7: 16,883,161 Q95P probably damaging Het
Dennd2c T C 3: 103,149,224 probably null Het
Dock2 G T 11: 34,232,874 H1586Q probably damaging Het
Dst T C 1: 34,182,690 M2525T probably benign Het
Egflam T C 15: 7,231,695 H786R probably damaging Het
Eml6 T C 11: 29,809,321 T811A probably benign Het
Epha1 T C 6: 42,366,172 T148A probably damaging Het
Fsip1 A C 2: 118,236,925 S306A probably damaging Het
Gga2 A T 7: 122,008,438 probably null Het
Gm10801 C CGTT 2: 98,663,807 probably benign Het
Gm12800 G A 4: 101,909,992 R146H probably benign Het
Gm5724 T A 6: 141,723,092 probably null Het
Gm9837 T A 11: 53,470,058 probably benign Het
Gnl2 A T 4: 125,046,265 Q310L probably damaging Het
H2-M1 T C 17: 36,671,809 D53G probably benign Het
Hmcn2 T A 2: 31,369,257 D1036E probably damaging Het
Igdcc4 G A 9: 65,135,118 G106R probably damaging Het
Igfbp2 A G 1: 72,824,919 T114A probably damaging Het
Ints14 A G 9: 64,978,124 probably null Het
Kcnt1 T A 2: 25,909,239 M906K possibly damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lars2 A G 9: 123,371,925 Q18R probably benign Het
Mndal C T 1: 173,871,433 C222Y possibly damaging Het
Msto1 C T 3: 88,905,474 A1854V possibly damaging Het
Musk G A 4: 58,286,169 G20R probably benign Het
Olfr811 G T 10: 129,802,144 P127Q probably damaging Het
Oxct1 G T 15: 4,026,827 S19I possibly damaging Het
Papss2 G A 19: 32,664,476 G517D probably damaging Het
Parp14 T C 16: 35,856,548 S1017G probably benign Het
Pde2a A G 7: 101,501,035 Q227R probably benign Het
Pdlim5 G T 3: 142,314,422 P92Q probably damaging Het
Pkd1l3 C T 8: 109,623,963 T480I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Ppp3ca A G 3: 136,877,770 R213G possibly damaging Het
Prrc1 C T 18: 57,362,547 S32L probably null Het
Prss47 C T 13: 65,049,302 V207I probably benign Het
Prtg G A 9: 72,912,132 V1136I possibly damaging Het
Psmb8 T A 17: 34,199,291 M69K possibly damaging Het
Rb1 A T 14: 73,199,196 D876E probably damaging Het
Rnasel T C 1: 153,762,121 M680T probably damaging Het
Rnf111 G T 9: 70,476,410 N80K possibly damaging Het
Senp1 C T 15: 98,048,193 C557Y probably damaging Het
Serpina3a A T 12: 104,116,451 Y161F probably damaging Het
Serpinb11 A T 1: 107,372,051 probably null Het
Sgpl1 C A 10: 61,112,157 probably null Het
Slc37a4 A G 9: 44,399,279 Y60C probably damaging Het
Slc38a10 A G 11: 120,124,382 S381P probably benign Het
Slc5a7 C T 17: 54,278,821 V323I probably damaging Het
Smarcal1 A T 1: 72,616,557 E665V possibly damaging Het
Specc1 C A 11: 62,132,338 N736K probably damaging Het
Tas2r121 T C 6: 132,700,532 Y159C probably benign Het
Trank1 A G 9: 111,367,200 I1431V probably damaging Het
Ttll6 T C 11: 96,156,588 V671A probably benign Het
Ttn A T 2: 76,918,587 probably benign Het
Uimc1 T C 13: 55,040,576 T557A possibly damaging Het
Uri1 C A 7: 37,962,549 V446L probably benign Het
Vpreb2 C T 16: 17,980,907 R86C probably damaging Het
Vwa8 A G 14: 79,093,744 K1231E probably benign Het
Xcr1 G A 9: 123,855,789 R303C probably damaging Het
Zfp619 C A 7: 39,537,030 A828E possibly damaging Het
Zfp687 T C 3: 95,007,738 S1151G possibly damaging Het
Other mutations in Htr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02314:Htr3a APN 9 48904627 missense probably damaging 0.99
R0238:Htr3a UTSW 9 48906386 missense probably benign 0.06
R0238:Htr3a UTSW 9 48906386 missense probably benign 0.06
R0403:Htr3a UTSW 9 48908659 missense probably damaging 0.96
R0899:Htr3a UTSW 9 48901452 missense possibly damaging 0.78
R1749:Htr3a UTSW 9 48900933 missense probably damaging 1.00
R1903:Htr3a UTSW 9 48906381 missense probably damaging 1.00
R1942:Htr3a UTSW 9 48908611 missense probably damaging 1.00
R2218:Htr3a UTSW 9 48908611 missense probably damaging 1.00
R2394:Htr3a UTSW 9 48906343 missense probably benign 0.29
R2402:Htr3a UTSW 9 48901495 missense probably damaging 1.00
R3430:Htr3a UTSW 9 48907388 missense probably benign 0.35
R6042:Htr3a UTSW 9 48904699 missense probably damaging 0.99
R6407:Htr3a UTSW 9 48901055 nonsense probably null
R7791:Htr3a UTSW 9 48901575 missense possibly damaging 0.79
R8724:Htr3a UTSW 9 48904681 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCATCCTTAAGCTGATTGAAGG -3'
(R):5'- CGCTGAGACCATCTTCATTGTG -3'

Sequencing Primer
(F):5'- CTACATAGTGAGTTCCAGGTCAGC -3'
(R):5'- GACCATCTTCATTGTGCGGCTG -3'
Posted On2018-05-04