Incidental Mutation 'R6395:Trank1'
ID514725
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Nametetratricopeptide repeat and ankyrin repeat containing 1
SynonymsA230061D21Rik, LOC235639, C030048J01Rik, Lba1
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6395 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location111311739-111395775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111367200 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1431 (I1431V)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
Predicted Effect probably damaging
Transcript: ENSMUST00000078626
AA Change: I1431V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: I1431V

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,741,098 D68G probably benign Het
Actc1 C A 2: 114,049,250 E243* probably null Het
Ahi1 T C 10: 20,979,592 I600T possibly damaging Het
Apob A G 12: 8,008,507 T2330A probably benign Het
BC067074 T G 13: 113,369,469 C2377W probably damaging Het
Cabin1 A T 10: 75,746,742 M280K probably benign Het
Ccdc117 T C 11: 5,534,762 probably null Het
Cct8 G T 16: 87,486,476 Y292* probably null Het
Celf1 A G 2: 91,003,858 I165V probably benign Het
Cenpc1 A T 5: 86,035,570 N453K probably benign Het
Chst10 T C 1: 38,871,689 I131M probably damaging Het
Cltc A G 11: 86,725,180 I420T probably damaging Het
Dact3 A C 7: 16,883,161 Q95P probably damaging Het
Dennd2c T C 3: 103,149,224 probably null Het
Dock2 G T 11: 34,232,874 H1586Q probably damaging Het
Dst T C 1: 34,182,690 M2525T probably benign Het
Egflam T C 15: 7,231,695 H786R probably damaging Het
Eml6 T C 11: 29,809,321 T811A probably benign Het
Epha1 T C 6: 42,366,172 T148A probably damaging Het
Fsip1 A C 2: 118,236,925 S306A probably damaging Het
Gga2 A T 7: 122,008,438 probably null Het
Gm10801 C CGTT 2: 98,663,807 probably benign Het
Gm12800 G A 4: 101,909,992 R146H probably benign Het
Gm5724 T A 6: 141,723,092 probably null Het
Gm9837 T A 11: 53,470,058 probably benign Het
Gnl2 A T 4: 125,046,265 Q310L probably damaging Het
H2-M1 T C 17: 36,671,809 D53G probably benign Het
Hmcn2 T A 2: 31,369,257 D1036E probably damaging Het
Htr3a A T 9: 48,900,571 D381E probably benign Het
Igdcc4 G A 9: 65,135,118 G106R probably damaging Het
Igfbp2 A G 1: 72,824,919 T114A probably damaging Het
Ints14 A G 9: 64,978,124 probably null Het
Kcnt1 T A 2: 25,909,239 M906K possibly damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lars2 A G 9: 123,371,925 Q18R probably benign Het
Mndal C T 1: 173,871,433 C222Y possibly damaging Het
Msto1 C T 3: 88,905,474 A1854V possibly damaging Het
Musk G A 4: 58,286,169 G20R probably benign Het
Olfr811 G T 10: 129,802,144 P127Q probably damaging Het
Oxct1 G T 15: 4,026,827 S19I possibly damaging Het
Papss2 G A 19: 32,664,476 G517D probably damaging Het
Parp14 T C 16: 35,856,548 S1017G probably benign Het
Pde2a A G 7: 101,501,035 Q227R probably benign Het
Pdlim5 G T 3: 142,314,422 P92Q probably damaging Het
Pkd1l3 C T 8: 109,623,963 T480I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Ppp3ca A G 3: 136,877,770 R213G possibly damaging Het
Prrc1 C T 18: 57,362,547 S32L probably null Het
Prss47 C T 13: 65,049,302 V207I probably benign Het
Prtg G A 9: 72,912,132 V1136I possibly damaging Het
Psmb8 T A 17: 34,199,291 M69K possibly damaging Het
Rb1 A T 14: 73,199,196 D876E probably damaging Het
Rnasel T C 1: 153,762,121 M680T probably damaging Het
Rnf111 G T 9: 70,476,410 N80K possibly damaging Het
Senp1 C T 15: 98,048,193 C557Y probably damaging Het
Serpina3a A T 12: 104,116,451 Y161F probably damaging Het
Serpinb11 A T 1: 107,372,051 probably null Het
Sgpl1 C A 10: 61,112,157 probably null Het
Slc37a4 A G 9: 44,399,279 Y60C probably damaging Het
Slc38a10 A G 11: 120,124,382 S381P probably benign Het
Slc5a7 C T 17: 54,278,821 V323I probably damaging Het
Smarcal1 A T 1: 72,616,557 E665V possibly damaging Het
Specc1 C A 11: 62,132,338 N736K probably damaging Het
Tas2r121 T C 6: 132,700,532 Y159C probably benign Het
Ttll6 T C 11: 96,156,588 V671A probably benign Het
Ttn A T 2: 76,918,587 probably benign Het
Uimc1 T C 13: 55,040,576 T557A possibly damaging Het
Uri1 C A 7: 37,962,549 V446L probably benign Het
Vpreb2 C T 16: 17,980,907 R86C probably damaging Het
Vwa8 A G 14: 79,093,744 K1231E probably benign Het
Xcr1 G A 9: 123,855,789 R303C probably damaging Het
Zfp619 C A 7: 39,537,030 A828E possibly damaging Het
Zfp687 T C 3: 95,007,738 S1151G possibly damaging Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
PIT4486001:Trank1 UTSW 9 111390107 missense probably damaging 1.00
PIT4812001:Trank1 UTSW 9 111347912 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
R7127:Trank1 UTSW 9 111365796 missense possibly damaging 0.85
R7206:Trank1 UTSW 9 111345515 critical splice donor site probably null
R7236:Trank1 UTSW 9 111373074 missense possibly damaging 0.93
R7247:Trank1 UTSW 9 111367512 missense probably damaging 1.00
R7292:Trank1 UTSW 9 111377870 missense probably benign 0.02
R7310:Trank1 UTSW 9 111367126 missense probably damaging 1.00
R7431:Trank1 UTSW 9 111362402 missense probably benign 0.12
R7448:Trank1 UTSW 9 111366349 missense probably benign 0.01
R7477:Trank1 UTSW 9 111364957 missense probably benign 0.00
R7514:Trank1 UTSW 9 111364756 missense probably damaging 1.00
R7595:Trank1 UTSW 9 111365991 missense probably damaging 1.00
R7637:Trank1 UTSW 9 111365296 missense possibly damaging 0.71
R7648:Trank1 UTSW 9 111391685 missense probably benign
R7737:Trank1 UTSW 9 111366012 nonsense probably null
R7784:Trank1 UTSW 9 111364103 missense probably damaging 1.00
R7884:Trank1 UTSW 9 111392516 missense probably benign
R7912:Trank1 UTSW 9 111391528 missense probably benign 0.04
R7938:Trank1 UTSW 9 111365028 missense probably benign
R7979:Trank1 UTSW 9 111377899 missense probably benign 0.00
R8064:Trank1 UTSW 9 111352076 nonsense probably null
R8100:Trank1 UTSW 9 111392793 missense probably damaging 1.00
R8124:Trank1 UTSW 9 111378927 missense probably benign 0.31
R8198:Trank1 UTSW 9 111390812 missense probably benign 0.09
R8219:Trank1 UTSW 9 111364909 missense probably damaging 1.00
R8223:Trank1 UTSW 9 111365889 missense probably damaging 1.00
R8316:Trank1 UTSW 9 111349302 missense probably benign 0.38
R8347:Trank1 UTSW 9 111367249 missense probably damaging 1.00
R8436:Trank1 UTSW 9 111391382 missense possibly damaging 0.86
R8489:Trank1 UTSW 9 111390275 missense probably benign 0.01
R8682:Trank1 UTSW 9 111365344 missense probably benign 0.01
R8768:Trank1 UTSW 9 111389276 missense probably benign 0.00
R8770:Trank1 UTSW 9 111390824 missense probably benign 0.00
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Z1177:Trank1 UTSW 9 111311902 missense unknown
Z1177:Trank1 UTSW 9 111367377 missense possibly damaging 0.83
Z1177:Trank1 UTSW 9 111392870 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCAAAGGGAGAAGTTCCTACAACC -3'
(R):5'- TGGGCAGTGTCTCCAGTAAG -3'

Sequencing Primer
(F):5'- ACCCAGCACTGATTTGGAAAG -3'
(R):5'- TCCAGTAAGGAACATGGCGTTG -3'
Posted On2018-05-04