Incidental Mutation 'R6395:Slc38a10'
ID514739
Institutional Source Beutler Lab
Gene Symbol Slc38a10
Ensembl Gene ENSMUSG00000061306
Gene Namesolute carrier family 38, member 10
Synonyms1810073N04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6395 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location120103960-120151346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120124382 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 381 (S381P)
Ref Sequence ENSEMBL: ENSMUSP00000057615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045402] [ENSMUST00000053692] [ENSMUST00000076697] [ENSMUST00000103018] [ENSMUST00000179094]
Predicted Effect probably benign
Transcript: ENSMUST00000045402
SMART Domains Protein: ENSMUSP00000048675
Gene: ENSMUSG00000061306

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 1.5e-54 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 699 735 N/A INTRINSIC
low complexity region 827 837 N/A INTRINSIC
low complexity region 1011 1019 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053692
AA Change: S381P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000057615
Gene: ENSMUSG00000061306
AA Change: S381P

DomainStartEndE-ValueType
Pfam:Aa_trans 4 381 8.6e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076697
SMART Domains Protein: ENSMUSP00000075989
Gene: ENSMUSG00000061306

DomainStartEndE-ValueType
Pfam:Aa_trans 4 389 4.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103018
SMART Domains Protein: ENSMUSP00000099307
Gene: ENSMUSG00000061306

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 8.5e-55 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 707 743 N/A INTRINSIC
low complexity region 835 845 N/A INTRINSIC
low complexity region 1019 1027 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154444
Predicted Effect probably benign
Transcript: ENSMUST00000179094
SMART Domains Protein: ENSMUSP00000136719
Gene: ENSMUSG00000061306

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 1e-54 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 707 743 N/A INTRINSIC
low complexity region 835 845 N/A INTRINSIC
low complexity region 1019 1027 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit a fragile skeleton, reduced adiposity, lean body mass, body weight/length, long bone length and bone mineral density, increased creatinine levels, reduced amylase and serum albumin levels, increased energy efficiency and oxygen consumption, and altered liver physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,741,098 D68G probably benign Het
Actc1 C A 2: 114,049,250 E243* probably null Het
Ahi1 T C 10: 20,979,592 I600T possibly damaging Het
Apob A G 12: 8,008,507 T2330A probably benign Het
BC067074 T G 13: 113,369,469 C2377W probably damaging Het
Cabin1 A T 10: 75,746,742 M280K probably benign Het
Ccdc117 T C 11: 5,534,762 probably null Het
Cct8 G T 16: 87,486,476 Y292* probably null Het
Celf1 A G 2: 91,003,858 I165V probably benign Het
Cenpc1 A T 5: 86,035,570 N453K probably benign Het
Chst10 T C 1: 38,871,689 I131M probably damaging Het
Cltc A G 11: 86,725,180 I420T probably damaging Het
Dact3 A C 7: 16,883,161 Q95P probably damaging Het
Dennd2c T C 3: 103,149,224 probably null Het
Dock2 G T 11: 34,232,874 H1586Q probably damaging Het
Dst T C 1: 34,182,690 M2525T probably benign Het
Egflam T C 15: 7,231,695 H786R probably damaging Het
Eml6 T C 11: 29,809,321 T811A probably benign Het
Epha1 T C 6: 42,366,172 T148A probably damaging Het
Fsip1 A C 2: 118,236,925 S306A probably damaging Het
Gga2 A T 7: 122,008,438 probably null Het
Gm10801 C CGTT 2: 98,663,807 probably benign Het
Gm12800 G A 4: 101,909,992 R146H probably benign Het
Gm5724 T A 6: 141,723,092 probably null Het
Gm9837 T A 11: 53,470,058 probably benign Het
Gnl2 A T 4: 125,046,265 Q310L probably damaging Het
H2-M1 T C 17: 36,671,809 D53G probably benign Het
Hmcn2 T A 2: 31,369,257 D1036E probably damaging Het
Htr3a A T 9: 48,900,571 D381E probably benign Het
Igdcc4 G A 9: 65,135,118 G106R probably damaging Het
Igfbp2 A G 1: 72,824,919 T114A probably damaging Het
Ints14 A G 9: 64,978,124 probably null Het
Kcnt1 T A 2: 25,909,239 M906K possibly damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lars2 A G 9: 123,371,925 Q18R probably benign Het
Mndal C T 1: 173,871,433 C222Y possibly damaging Het
Msto1 C T 3: 88,905,474 A1854V possibly damaging Het
Musk G A 4: 58,286,169 G20R probably benign Het
Olfr811 G T 10: 129,802,144 P127Q probably damaging Het
Oxct1 G T 15: 4,026,827 S19I possibly damaging Het
Papss2 G A 19: 32,664,476 G517D probably damaging Het
Parp14 T C 16: 35,856,548 S1017G probably benign Het
Pde2a A G 7: 101,501,035 Q227R probably benign Het
Pdlim5 G T 3: 142,314,422 P92Q probably damaging Het
Pkd1l3 C T 8: 109,623,963 T480I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Ppp3ca A G 3: 136,877,770 R213G possibly damaging Het
Prrc1 C T 18: 57,362,547 S32L probably null Het
Prss47 C T 13: 65,049,302 V207I probably benign Het
Prtg G A 9: 72,912,132 V1136I possibly damaging Het
Psmb8 T A 17: 34,199,291 M69K possibly damaging Het
Rb1 A T 14: 73,199,196 D876E probably damaging Het
Rnasel T C 1: 153,762,121 M680T probably damaging Het
Rnf111 G T 9: 70,476,410 N80K possibly damaging Het
Senp1 C T 15: 98,048,193 C557Y probably damaging Het
Serpina3a A T 12: 104,116,451 Y161F probably damaging Het
Serpinb11 A T 1: 107,372,051 probably null Het
Sgpl1 C A 10: 61,112,157 probably null Het
Slc37a4 A G 9: 44,399,279 Y60C probably damaging Het
Slc5a7 C T 17: 54,278,821 V323I probably damaging Het
Smarcal1 A T 1: 72,616,557 E665V possibly damaging Het
Specc1 C A 11: 62,132,338 N736K probably damaging Het
Tas2r121 T C 6: 132,700,532 Y159C probably benign Het
Trank1 A G 9: 111,367,200 I1431V probably damaging Het
Ttll6 T C 11: 96,156,588 V671A probably benign Het
Ttn A T 2: 76,918,587 probably benign Het
Uimc1 T C 13: 55,040,576 T557A possibly damaging Het
Uri1 C A 7: 37,962,549 V446L probably benign Het
Vpreb2 C T 16: 17,980,907 R86C probably damaging Het
Vwa8 A G 14: 79,093,744 K1231E probably benign Het
Xcr1 G A 9: 123,855,789 R303C probably damaging Het
Zfp619 C A 7: 39,537,030 A828E possibly damaging Het
Zfp687 T C 3: 95,007,738 S1151G possibly damaging Het
Other mutations in Slc38a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Slc38a10 APN 11 120138988 missense probably damaging 1.00
IGL00236:Slc38a10 APN 11 120106602 missense probably damaging 0.96
IGL01420:Slc38a10 APN 11 120106460 missense probably damaging 0.99
IGL01704:Slc38a10 APN 11 120151087 utr 5 prime probably benign
IGL01747:Slc38a10 APN 11 120134774 splice site probably benign
IGL02295:Slc38a10 APN 11 120116858 splice site probably benign
IGL02300:Slc38a10 APN 11 120110290 missense probably benign 0.00
IGL02429:Slc38a10 APN 11 120134888 splice site probably benign
IGL03155:Slc38a10 APN 11 120105119 missense probably damaging 0.96
IGL03396:Slc38a10 APN 11 120128475 missense probably damaging 1.00
Cascade UTSW 11 120147819 missense probably damaging 1.00
cherries UTSW 11 120151077 start codon destroyed probably null 1.00
Ore UTSW 11 120134853 missense probably damaging 1.00
rainier UTSW 11 120129312 nonsense probably null
slag UTSW 11 120132741 missense probably damaging 1.00
R0048:Slc38a10 UTSW 11 120110312 missense probably benign 0.11
R0068:Slc38a10 UTSW 11 120134853 missense probably damaging 1.00
R0068:Slc38a10 UTSW 11 120134853 missense probably damaging 1.00
R0069:Slc38a10 UTSW 11 120106502 missense probably damaging 1.00
R0101:Slc38a10 UTSW 11 120151077 start codon destroyed probably null 1.00
R0743:Slc38a10 UTSW 11 120140643 missense probably damaging 1.00
R1159:Slc38a10 UTSW 11 120105475 missense probably benign
R2101:Slc38a10 UTSW 11 120132741 missense probably damaging 1.00
R2367:Slc38a10 UTSW 11 120110261 missense probably benign 0.12
R4280:Slc38a10 UTSW 11 120137878 missense probably damaging 1.00
R4282:Slc38a10 UTSW 11 120129264 missense probably damaging 1.00
R5206:Slc38a10 UTSW 11 120105062 missense probably damaging 0.99
R5658:Slc38a10 UTSW 11 120105392 missense probably benign 0.11
R6114:Slc38a10 UTSW 11 120129312 nonsense probably null
R6118:Slc38a10 UTSW 11 120132843 missense probably damaging 1.00
R6306:Slc38a10 UTSW 11 120147819 missense probably damaging 1.00
R6428:Slc38a10 UTSW 11 120105472 missense probably benign 0.09
X0062:Slc38a10 UTSW 11 120116900 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CCGCACACCAGAGTATTAGC -3'
(R):5'- GGGCCTAAAGTCACAAACTGG -3'

Sequencing Primer
(F):5'- GAACAGAGACGTTCGTTTATCGCTC -3'
(R):5'- CCTGCCTTTCAGTGTGAGGC -3'
Posted On2018-05-04