Incidental Mutation 'R6395:Senp1'
ID514750
Institutional Source Beutler Lab
Gene Symbol Senp1
Ensembl Gene ENSMUSG00000033075
Gene NameSUMO1/sentrin specific peptidase 1
Synonyms2310046A20Rik, D15Ertd528e, E330036L07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6395 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location98038744-98093744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98048193 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 557 (C557Y)
Ref Sequence ENSEMBL: ENSMUSP00000138056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044189] [ENSMUST00000180657] [ENSMUST00000180716]
Predicted Effect probably damaging
Transcript: ENSMUST00000044189
AA Change: C531Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046598
Gene: ENSMUSG00000033075
AA Change: C531Y

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
low complexity region 183 192 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
low complexity region 357 375 N/A INTRINSIC
Pfam:Peptidase_C48 460 638 1.3e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180461
SMART Domains Protein: ENSMUSP00000137769
Gene: ENSMUSG00000033075

DomainStartEndE-ValueType
Pfam:Peptidase_C48 1 169 2.2e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180657
AA Change: C557Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138056
Gene: ENSMUSG00000033075
AA Change: C557Y

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
low complexity region 183 192 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
low complexity region 383 401 N/A INTRINSIC
Pfam:Peptidase_C48 486 664 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180716
SMART Domains Protein: ENSMUSP00000138032
Gene: ENSMUSG00000033075

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181855
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cysteine protease that specifically targets members of the small ubiquitin-like modifier (SUMO) protein family. This protease regulates SUMO pathways by deconjugating sumoylated proteins. This protease also functions to process the precursor SUMO proteins into their mature form. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous mutant mice die before birth. Depending on the allele mice may exhibit placental labyrinth defects and widespread cell death or severe anemia and a defect in definitive erythropoiesis in the fetal liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,741,098 D68G probably benign Het
Actc1 C A 2: 114,049,250 E243* probably null Het
Ahi1 T C 10: 20,979,592 I600T possibly damaging Het
Apob A G 12: 8,008,507 T2330A probably benign Het
BC067074 T G 13: 113,369,469 C2377W probably damaging Het
Cabin1 A T 10: 75,746,742 M280K probably benign Het
Ccdc117 T C 11: 5,534,762 probably null Het
Cct8 G T 16: 87,486,476 Y292* probably null Het
Celf1 A G 2: 91,003,858 I165V probably benign Het
Cenpc1 A T 5: 86,035,570 N453K probably benign Het
Chst10 T C 1: 38,871,689 I131M probably damaging Het
Cltc A G 11: 86,725,180 I420T probably damaging Het
Dact3 A C 7: 16,883,161 Q95P probably damaging Het
Dennd2c T C 3: 103,149,224 probably null Het
Dock2 G T 11: 34,232,874 H1586Q probably damaging Het
Dst T C 1: 34,182,690 M2525T probably benign Het
Egflam T C 15: 7,231,695 H786R probably damaging Het
Eml6 T C 11: 29,809,321 T811A probably benign Het
Epha1 T C 6: 42,366,172 T148A probably damaging Het
Fsip1 A C 2: 118,236,925 S306A probably damaging Het
Gga2 A T 7: 122,008,438 probably null Het
Gm10801 C CGTT 2: 98,663,807 probably benign Het
Gm12800 G A 4: 101,909,992 R146H probably benign Het
Gm5724 T A 6: 141,723,092 probably null Het
Gm9837 T A 11: 53,470,058 probably benign Het
Gnl2 A T 4: 125,046,265 Q310L probably damaging Het
H2-M1 T C 17: 36,671,809 D53G probably benign Het
Hmcn2 T A 2: 31,369,257 D1036E probably damaging Het
Htr3a A T 9: 48,900,571 D381E probably benign Het
Igdcc4 G A 9: 65,135,118 G106R probably damaging Het
Igfbp2 A G 1: 72,824,919 T114A probably damaging Het
Ints14 A G 9: 64,978,124 probably null Het
Kcnt1 T A 2: 25,909,239 M906K possibly damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lars2 A G 9: 123,371,925 Q18R probably benign Het
Mndal C T 1: 173,871,433 C222Y possibly damaging Het
Msto1 C T 3: 88,905,474 A1854V possibly damaging Het
Musk G A 4: 58,286,169 G20R probably benign Het
Olfr811 G T 10: 129,802,144 P127Q probably damaging Het
Oxct1 G T 15: 4,026,827 S19I possibly damaging Het
Papss2 G A 19: 32,664,476 G517D probably damaging Het
Parp14 T C 16: 35,856,548 S1017G probably benign Het
Pde2a A G 7: 101,501,035 Q227R probably benign Het
Pdlim5 G T 3: 142,314,422 P92Q probably damaging Het
Pkd1l3 C T 8: 109,623,963 T480I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Ppp3ca A G 3: 136,877,770 R213G possibly damaging Het
Prrc1 C T 18: 57,362,547 S32L probably null Het
Prss47 C T 13: 65,049,302 V207I probably benign Het
Prtg G A 9: 72,912,132 V1136I possibly damaging Het
Psmb8 T A 17: 34,199,291 M69K possibly damaging Het
Rb1 A T 14: 73,199,196 D876E probably damaging Het
Rnasel T C 1: 153,762,121 M680T probably damaging Het
Rnf111 G T 9: 70,476,410 N80K possibly damaging Het
Serpina3a A T 12: 104,116,451 Y161F probably damaging Het
Serpinb11 A T 1: 107,372,051 probably null Het
Sgpl1 C A 10: 61,112,157 probably null Het
Slc37a4 A G 9: 44,399,279 Y60C probably damaging Het
Slc38a10 A G 11: 120,124,382 S381P probably benign Het
Slc5a7 C T 17: 54,278,821 V323I probably damaging Het
Smarcal1 A T 1: 72,616,557 E665V possibly damaging Het
Specc1 C A 11: 62,132,338 N736K probably damaging Het
Tas2r121 T C 6: 132,700,532 Y159C probably benign Het
Trank1 A G 9: 111,367,200 I1431V probably damaging Het
Ttll6 T C 11: 96,156,588 V671A probably benign Het
Ttn A T 2: 76,918,587 probably benign Het
Uimc1 T C 13: 55,040,576 T557A possibly damaging Het
Uri1 C A 7: 37,962,549 V446L probably benign Het
Vpreb2 C T 16: 17,980,907 R86C probably damaging Het
Vwa8 A G 14: 79,093,744 K1231E probably benign Het
Xcr1 G A 9: 123,855,789 R303C probably damaging Het
Zfp619 C A 7: 39,537,030 A828E possibly damaging Het
Zfp687 T C 3: 95,007,738 S1151G possibly damaging Het
Other mutations in Senp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Senp1 APN 15 98064838 missense probably damaging 1.00
IGL01431:Senp1 APN 15 98082263 missense probably damaging 0.97
IGL02674:Senp1 APN 15 98056959 missense probably damaging 0.99
IGL03289:Senp1 APN 15 98085045 missense probably damaging 1.00
Calmate UTSW 15 98066498 missense probably benign 0.00
mustard UTSW 15 98048271 missense probably damaging 1.00
nitrogen UTSW 15 98066531 missense possibly damaging 0.61
Sinapis UTSW 15 98064880 splice site probably benign
PIT1430001:Senp1 UTSW 15 98084989 missense probably damaging 1.00
R0026:Senp1 UTSW 15 98076668 missense probably damaging 0.99
R0026:Senp1 UTSW 15 98076668 missense probably damaging 0.99
R0125:Senp1 UTSW 15 98048231 missense probably damaging 0.99
R0531:Senp1 UTSW 15 98064880 splice site probably benign
R1389:Senp1 UTSW 15 98075853 missense probably benign 0.03
R1396:Senp1 UTSW 15 98076554 missense probably benign 0.01
R1786:Senp1 UTSW 15 98075967 missense probably benign 0.00
R1999:Senp1 UTSW 15 98058315 missense possibly damaging 0.61
R2045:Senp1 UTSW 15 98059944 missense possibly damaging 0.57
R2130:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2132:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2133:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2150:Senp1 UTSW 15 98058315 missense possibly damaging 0.61
R2327:Senp1 UTSW 15 98082284 missense probably damaging 1.00
R3815:Senp1 UTSW 15 98056832 missense probably damaging 1.00
R4719:Senp1 UTSW 15 98056850 missense probably benign 0.42
R4766:Senp1 UTSW 15 98045896 missense probably damaging 0.98
R4866:Senp1 UTSW 15 98066848 missense possibly damaging 0.93
R5141:Senp1 UTSW 15 98076607 missense probably benign 0.08
R5485:Senp1 UTSW 15 98066496 missense probably benign 0.00
R5651:Senp1 UTSW 15 98076617 missense probably benign
R5668:Senp1 UTSW 15 98048355 missense probably damaging 1.00
R5729:Senp1 UTSW 15 98066531 missense possibly damaging 0.61
R6041:Senp1 UTSW 15 98058216 missense probably damaging 0.97
R6521:Senp1 UTSW 15 98048271 missense probably damaging 1.00
R7070:Senp1 UTSW 15 98082306 missense possibly damaging 0.66
R7075:Senp1 UTSW 15 98058326 missense probably benign 0.00
R7262:Senp1 UTSW 15 98066498 missense probably benign 0.00
R7625:Senp1 UTSW 15 98066798 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGGATGACCTGTAACTTCCG -3'
(R):5'- TGTGTAATGTCTTCCTGCAGATC -3'

Sequencing Primer
(F):5'- GATGACCTGTAACTTCCGAACCTAAG -3'
(R):5'- TCTACATGAACATGCTAATGGAACGC -3'
Posted On2018-05-04