Incidental Mutation 'R6395:Slc5a7'
ID514756
Institutional Source Beutler Lab
Gene Symbol Slc5a7
Ensembl Gene ENSMUSG00000023945
Gene Namesolute carrier family 5 (choline transporter), member 7
SynonymsCHT1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6395 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location54273594-54299034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54278821 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 323 (V323I)
Ref Sequence ENSEMBL: ENSMUSP00000093379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095712]
Predicted Effect probably damaging
Transcript: ENSMUST00000095712
AA Change: V323I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093379
Gene: ENSMUSG00000023945
AA Change: V323I

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:SSF 42 442 4.7e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium ion- and chloride ion-dependent high-affinity transporter that mediates choline uptake for acetylcholine synthesis in cholinergic neurons. The protein transports choline from the extracellular space into presynaptic terminals for synthesis into acetylcholine. Increased choline uptake results from increased density of this protein in synaptosomal plasma membranes in response to depolarization of cholinergic terminals. Dysfunction of cholinergic signaling has been implicated in various disorders including depression, attention-deficit disorder, and schizophrenia. An allelic variant of this gene is associated with autosomal dominant distal hereditary motor neuronopathy type VIIA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice display neonatal lethality with respiratory failure, hyporesponsiveness to touch, inability to sustain acetylcholine release, and abnormal neuromuscular junction morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,741,098 D68G probably benign Het
Actc1 C A 2: 114,049,250 E243* probably null Het
Ahi1 T C 10: 20,979,592 I600T possibly damaging Het
Apob A G 12: 8,008,507 T2330A probably benign Het
BC067074 T G 13: 113,369,469 C2377W probably damaging Het
Cabin1 A T 10: 75,746,742 M280K probably benign Het
Ccdc117 T C 11: 5,534,762 probably null Het
Cct8 G T 16: 87,486,476 Y292* probably null Het
Celf1 A G 2: 91,003,858 I165V probably benign Het
Cenpc1 A T 5: 86,035,570 N453K probably benign Het
Chst10 T C 1: 38,871,689 I131M probably damaging Het
Cltc A G 11: 86,725,180 I420T probably damaging Het
Dact3 A C 7: 16,883,161 Q95P probably damaging Het
Dennd2c T C 3: 103,149,224 probably null Het
Dock2 G T 11: 34,232,874 H1586Q probably damaging Het
Dst T C 1: 34,182,690 M2525T probably benign Het
Egflam T C 15: 7,231,695 H786R probably damaging Het
Eml6 T C 11: 29,809,321 T811A probably benign Het
Epha1 T C 6: 42,366,172 T148A probably damaging Het
Fsip1 A C 2: 118,236,925 S306A probably damaging Het
Gga2 A T 7: 122,008,438 probably null Het
Gm10801 C CGTT 2: 98,663,807 probably benign Het
Gm12800 G A 4: 101,909,992 R146H probably benign Het
Gm5724 T A 6: 141,723,092 probably null Het
Gm9837 T A 11: 53,470,058 probably benign Het
Gnl2 A T 4: 125,046,265 Q310L probably damaging Het
H2-M1 T C 17: 36,671,809 D53G probably benign Het
Hmcn2 T A 2: 31,369,257 D1036E probably damaging Het
Htr3a A T 9: 48,900,571 D381E probably benign Het
Igdcc4 G A 9: 65,135,118 G106R probably damaging Het
Igfbp2 A G 1: 72,824,919 T114A probably damaging Het
Ints14 A G 9: 64,978,124 probably null Het
Kcnt1 T A 2: 25,909,239 M906K possibly damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lars2 A G 9: 123,371,925 Q18R probably benign Het
Mndal C T 1: 173,871,433 C222Y possibly damaging Het
Msto1 C T 3: 88,905,474 A1854V possibly damaging Het
Musk G A 4: 58,286,169 G20R probably benign Het
Olfr811 G T 10: 129,802,144 P127Q probably damaging Het
Oxct1 G T 15: 4,026,827 S19I possibly damaging Het
Papss2 G A 19: 32,664,476 G517D probably damaging Het
Parp14 T C 16: 35,856,548 S1017G probably benign Het
Pde2a A G 7: 101,501,035 Q227R probably benign Het
Pdlim5 G T 3: 142,314,422 P92Q probably damaging Het
Pkd1l3 C T 8: 109,623,963 T480I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Ppp3ca A G 3: 136,877,770 R213G possibly damaging Het
Prrc1 C T 18: 57,362,547 S32L probably null Het
Prss47 C T 13: 65,049,302 V207I probably benign Het
Prtg G A 9: 72,912,132 V1136I possibly damaging Het
Psmb8 T A 17: 34,199,291 M69K possibly damaging Het
Rb1 A T 14: 73,199,196 D876E probably damaging Het
Rnasel T C 1: 153,762,121 M680T probably damaging Het
Rnf111 G T 9: 70,476,410 N80K possibly damaging Het
Senp1 C T 15: 98,048,193 C557Y probably damaging Het
Serpina3a A T 12: 104,116,451 Y161F probably damaging Het
Serpinb11 A T 1: 107,372,051 probably null Het
Sgpl1 C A 10: 61,112,157 probably null Het
Slc37a4 A G 9: 44,399,279 Y60C probably damaging Het
Slc38a10 A G 11: 120,124,382 S381P probably benign Het
Smarcal1 A T 1: 72,616,557 E665V possibly damaging Het
Specc1 C A 11: 62,132,338 N736K probably damaging Het
Tas2r121 T C 6: 132,700,532 Y159C probably benign Het
Trank1 A G 9: 111,367,200 I1431V probably damaging Het
Ttll6 T C 11: 96,156,588 V671A probably benign Het
Ttn A T 2: 76,918,587 probably benign Het
Uimc1 T C 13: 55,040,576 T557A possibly damaging Het
Uri1 C A 7: 37,962,549 V446L probably benign Het
Vpreb2 C T 16: 17,980,907 R86C probably damaging Het
Vwa8 A G 14: 79,093,744 K1231E probably benign Het
Xcr1 G A 9: 123,855,789 R303C probably damaging Het
Zfp619 C A 7: 39,537,030 A828E possibly damaging Het
Zfp687 T C 3: 95,007,738 S1151G possibly damaging Het
Other mutations in Slc5a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Slc5a7 APN 17 54292960 missense probably benign 0.00
IGL01833:Slc5a7 APN 17 54281833 missense probably damaging 1.00
IGL02206:Slc5a7 APN 17 54296994 missense probably damaging 0.98
IGL02493:Slc5a7 APN 17 54293880 missense probably damaging 1.00
IGL02598:Slc5a7 APN 17 54284193 missense probably benign
IGL02693:Slc5a7 APN 17 54276919 missense probably benign 0.00
IGL02896:Slc5a7 APN 17 54293017 nonsense probably null
R0288:Slc5a7 UTSW 17 54293018 nonsense probably null
R1137:Slc5a7 UTSW 17 54293011 missense probably damaging 1.00
R1692:Slc5a7 UTSW 17 54281726 missense probably damaging 0.99
R1755:Slc5a7 UTSW 17 54292978 missense probably benign 0.01
R1987:Slc5a7 UTSW 17 54293835 missense probably damaging 1.00
R2373:Slc5a7 UTSW 17 54277126 missense probably damaging 1.00
R4170:Slc5a7 UTSW 17 54276858 missense probably benign 0.08
R4614:Slc5a7 UTSW 17 54276559 missense probably benign 0.00
R4785:Slc5a7 UTSW 17 54278700 missense probably damaging 1.00
R4793:Slc5a7 UTSW 17 54281794 missense possibly damaging 0.95
R4828:Slc5a7 UTSW 17 54276799 missense probably benign 0.11
R4847:Slc5a7 UTSW 17 54277140 missense possibly damaging 0.82
R4879:Slc5a7 UTSW 17 54276651 missense probably benign 0.04
R5152:Slc5a7 UTSW 17 54278833 missense possibly damaging 0.51
R5171:Slc5a7 UTSW 17 54276676 missense probably benign
R5196:Slc5a7 UTSW 17 54281722 critical splice donor site probably null
R5935:Slc5a7 UTSW 17 54276944 nonsense probably null
R6307:Slc5a7 UTSW 17 54276978 missense probably benign 0.12
R6354:Slc5a7 UTSW 17 54277033 missense probably damaging 1.00
R6357:Slc5a7 UTSW 17 54287361 missense probably benign 0.16
R6500:Slc5a7 UTSW 17 54284203 missense probably benign
R6643:Slc5a7 UTSW 17 54276616 missense probably benign 0.00
R7062:Slc5a7 UTSW 17 54293001 missense probably damaging 1.00
R7405:Slc5a7 UTSW 17 54297133 missense probably benign
R7470:Slc5a7 UTSW 17 54276962 nonsense probably null
R7477:Slc5a7 UTSW 17 54281759 missense probably damaging 1.00
R7942:Slc5a7 UTSW 17 54276681 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGGCAATGGCAACGACTACTAG -3'
(R):5'- GAACGCTATCAATATTCGCTGG -3'

Sequencing Primer
(F):5'- TGGCAACGACTACTAGTACTACTAC -3'
(R):5'- TATCAATATTCGCTGGACCCAGG -3'
Posted On2018-05-04