Incidental Mutation 'R6409:Adgrf3'
ID514770
Institutional Source Beutler Lab
Gene Symbol Adgrf3
Ensembl Gene ENSMUSG00000067642
Gene Nameadhesion G protein-coupled receptor F3
SynonymsGpr113, LOC381628, PGR23
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6409 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location30193431-30205722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30197314 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 572 (V572A)
Ref Sequence ENSEMBL: ENSMUSP00000085440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]
Predicted Effect probably damaging
Transcript: ENSMUST00000088117
AA Change: V572A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: V572A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
low complexity region 403 415 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
GPS 632 684 2.68e-17 SMART
Pfam:7tm_2 687 935 1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125367
SMART Domains Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135322
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,262,071 probably benign Het
Aatk G T 11: 120,011,732 Q556K probably benign Het
Ahnak G A 19: 9,009,574 V2741M probably benign Het
Ascc3 T C 10: 50,845,580 V2043A probably benign Het
B3glct C T 5: 149,735,451 R239C probably benign Het
Cacna2d4 T A 6: 119,282,228 V626E probably damaging Het
Cfap54 T C 10: 92,967,492 N1563D probably benign Het
Duox2 G C 2: 122,284,667 H1110D probably damaging Het
Gm12794 C T 4: 101,940,677 Q91* probably null Het
Inppl1 A T 7: 101,828,961 F648I probably damaging Het
Mefv C A 16: 3,710,793 probably null Het
Ms4a4b T C 19: 11,461,360 probably null Het
Mtus2 T C 5: 148,077,615 V406A probably benign Het
Nup88 T C 11: 70,944,972 R554G probably null Het
Olfr1098 A T 2: 86,923,171 Y120* probably null Het
Olfr1425 C T 19: 12,074,747 probably benign Het
Olfr54 A G 11: 51,027,188 Y62C probably damaging Het
Pde10a A G 17: 8,949,438 D246G probably damaging Het
Pmm1 T C 15: 81,960,807 T9A probably benign Het
Psg18 T C 7: 18,353,521 M71V probably benign Het
Rapgef4 A G 2: 72,178,237 H253R probably benign Het
Rfc4 T C 16: 23,114,073 *371W probably null Het
Rgs18 T A 1: 144,775,193 K17* probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sertm1 T C 3: 54,899,367 Y79C probably benign Het
Sfrp1 T C 8: 23,417,378 I198T possibly damaging Het
Slc15a2 T A 16: 36,761,870 I254F probably benign Het
Slc29a4 A G 5: 142,712,071 D93G probably damaging Het
Smo T C 6: 29,736,114 L35S unknown Het
Tbc1d8 A G 1: 39,372,588 S1056P probably benign Het
Ttll9 A G 2: 152,999,341 D286G probably damaging Het
Vmn2r14 A G 5: 109,216,230 Y607H probably benign Het
Vps8 T A 16: 21,478,439 C564S probably benign Het
Zc3h12d A G 10: 7,867,318 H284R probably benign Het
Zfp106 A T 2: 120,532,104 S79T probably damaging Het
Other mutations in Adgrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Adgrf3 APN 5 30196829 missense probably benign 0.02
IGL03171:Adgrf3 APN 5 30196294 missense probably damaging 1.00
R0010:Adgrf3 UTSW 5 30205609 splice site probably benign
R0042:Adgrf3 UTSW 5 30197428 missense probably damaging 1.00
R0140:Adgrf3 UTSW 5 30196381 missense probably benign 0.19
R0617:Adgrf3 UTSW 5 30195080 missense probably benign 0.25
R0748:Adgrf3 UTSW 5 30196876 missense probably damaging 1.00
R1291:Adgrf3 UTSW 5 30199534 missense probably damaging 0.99
R1330:Adgrf3 UTSW 5 30195095 missense probably benign 0.24
R1468:Adgrf3 UTSW 5 30202229 splice site probably benign
R1695:Adgrf3 UTSW 5 30203555 missense probably benign 0.05
R1716:Adgrf3 UTSW 5 30197551 missense probably benign 0.03
R1844:Adgrf3 UTSW 5 30199213 missense probably damaging 0.96
R1935:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R1936:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R2059:Adgrf3 UTSW 5 30199491 missense possibly damaging 0.91
R2656:Adgrf3 UTSW 5 30196438 missense possibly damaging 0.96
R2913:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2914:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2987:Adgrf3 UTSW 5 30197360 missense probably damaging 1.00
R3797:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3798:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3799:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3934:Adgrf3 UTSW 5 30200434 unclassified probably benign
R4043:Adgrf3 UTSW 5 30204362 missense probably benign 0.00
R4080:Adgrf3 UTSW 5 30197369 nonsense probably null
R4575:Adgrf3 UTSW 5 30202257 missense probably benign 0.00
R4754:Adgrf3 UTSW 5 30197617 critical splice acceptor site probably null
R4819:Adgrf3 UTSW 5 30198444 missense possibly damaging 0.66
R4893:Adgrf3 UTSW 5 30200478 missense probably benign 0.00
R4991:Adgrf3 UTSW 5 30199148 missense probably benign 0.26
R5686:Adgrf3 UTSW 5 30197306 missense probably damaging 1.00
R5965:Adgrf3 UTSW 5 30205639 missense probably benign 0.00
R5997:Adgrf3 UTSW 5 30198362 critical splice donor site probably null
R6103:Adgrf3 UTSW 5 30196267 missense probably damaging 1.00
R6244:Adgrf3 UTSW 5 30197533 missense probably benign 0.17
R6575:Adgrf3 UTSW 5 30196524 missense possibly damaging 0.72
R6745:Adgrf3 UTSW 5 30203603 missense probably benign 0.31
R6790:Adgrf3 UTSW 5 30196387 missense probably benign 0.00
R6813:Adgrf3 UTSW 5 30197521 missense probably damaging 0.96
R7202:Adgrf3 UTSW 5 30204380 nonsense probably null
R7250:Adgrf3 UTSW 5 30195682 missense probably damaging 1.00
R7353:Adgrf3 UTSW 5 30198497 missense probably damaging 0.98
R7634:Adgrf3 UTSW 5 30202247 missense probably benign 0.01
R7658:Adgrf3 UTSW 5 30197206 missense probably benign 0.41
R8037:Adgrf3 UTSW 5 30199512 missense probably damaging 1.00
Z1088:Adgrf3 UTSW 5 30199120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACACAGTGAAGGGTTCCATTC -3'
(R):5'- TTCCTGAAGGCTGTGGAGAC -3'

Sequencing Primer
(F):5'- CACAGTGAAGGGTTCCATTCATGTC -3'
(R):5'- GAGACCTTGGTTCACAGCTTAAGAC -3'
Posted On2018-05-04