Incidental Mutation 'R6409:Psg18'
ID514777
Institutional Source Beutler Lab
Gene Symbol Psg18
Ensembl Gene ENSMUSG00000003505
Gene Namepregnancy specific glycoprotein 18
SynonymsCea-3, Cea3, mmCGM6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6409 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location18345422-18355009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18353521 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 71 (M71V)
Ref Sequence ENSEMBL: ENSMUSP00000003597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003597] [ENSMUST00000098783]
Predicted Effect probably benign
Transcript: ENSMUST00000003597
AA Change: M71V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003597
Gene: ENSMUSG00000003505
AA Change: M71V

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 140 2.11e-2 SMART
IG 161 262 1.03e0 SMART
IG 281 380 2.15e-3 SMART
IGc2 398 462 1.58e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098783
SMART Domains Protein: ENSMUSP00000096380
Gene: ENSMUSG00000003505

DomainStartEndE-ValueType
IG 40 141 1.03e0 SMART
IG 160 259 2.15e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182983
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,262,071 probably benign Het
Aatk G T 11: 120,011,732 Q556K probably benign Het
Adgrf3 A G 5: 30,197,314 V572A probably damaging Het
Ahnak G A 19: 9,009,574 V2741M probably benign Het
Ascc3 T C 10: 50,845,580 V2043A probably benign Het
B3glct C T 5: 149,735,451 R239C probably benign Het
Cacna2d4 T A 6: 119,282,228 V626E probably damaging Het
Cfap54 T C 10: 92,967,492 N1563D probably benign Het
Duox2 G C 2: 122,284,667 H1110D probably damaging Het
Gm12794 C T 4: 101,940,677 Q91* probably null Het
Inppl1 A T 7: 101,828,961 F648I probably damaging Het
Mefv C A 16: 3,710,793 probably null Het
Ms4a4b T C 19: 11,461,360 probably null Het
Mtus2 T C 5: 148,077,615 V406A probably benign Het
Nup88 T C 11: 70,944,972 R554G probably null Het
Olfr1098 A T 2: 86,923,171 Y120* probably null Het
Olfr1425 C T 19: 12,074,747 probably benign Het
Olfr54 A G 11: 51,027,188 Y62C probably damaging Het
Pde10a A G 17: 8,949,438 D246G probably damaging Het
Pmm1 T C 15: 81,960,807 T9A probably benign Het
Rapgef4 A G 2: 72,178,237 H253R probably benign Het
Rfc4 T C 16: 23,114,073 *371W probably null Het
Rgs18 T A 1: 144,775,193 K17* probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sertm1 T C 3: 54,899,367 Y79C probably benign Het
Sfrp1 T C 8: 23,417,378 I198T possibly damaging Het
Slc15a2 T A 16: 36,761,870 I254F probably benign Het
Slc29a4 A G 5: 142,712,071 D93G probably damaging Het
Smo T C 6: 29,736,114 L35S unknown Het
Tbc1d8 A G 1: 39,372,588 S1056P probably benign Het
Ttll9 A G 2: 152,999,341 D286G probably damaging Het
Vmn2r14 A G 5: 109,216,230 Y607H probably benign Het
Vps8 T A 16: 21,478,439 C564S probably benign Het
Zc3h12d A G 10: 7,867,318 H284R probably benign Het
Zfp106 A T 2: 120,532,104 S79T probably damaging Het
Other mutations in Psg18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Psg18 APN 7 18354816 start codon destroyed probably null 0.99
IGL01748:Psg18 APN 7 18353551 missense probably benign 0.05
IGL01767:Psg18 APN 7 18353397 missense possibly damaging 0.80
IGL02727:Psg18 APN 7 18345950 missense probably damaging 1.00
IGL02744:Psg18 APN 7 18349402 missense probably benign 0.38
PIT4466001:Psg18 UTSW 7 18349316 missense probably benign 0.30
R0331:Psg18 UTSW 7 18353308 missense probably benign 0.03
R1077:Psg18 UTSW 7 18351075 missense possibly damaging 0.84
R1171:Psg18 UTSW 7 18346079 missense probably benign 0.10
R1173:Psg18 UTSW 7 18354817 start codon destroyed probably null 0.97
R1234:Psg18 UTSW 7 18349190 missense probably damaging 1.00
R1553:Psg18 UTSW 7 18353481 missense probably benign 0.19
R1632:Psg18 UTSW 7 18350899 missense probably benign 0.02
R2108:Psg18 UTSW 7 18350874 missense probably damaging 1.00
R2439:Psg18 UTSW 7 18346119 missense probably benign 0.24
R3032:Psg18 UTSW 7 18350979 missense probably benign 0.01
R3053:Psg18 UTSW 7 18349193 missense probably damaging 1.00
R3432:Psg18 UTSW 7 18349171 missense possibly damaging 0.61
R3725:Psg18 UTSW 7 18354823 start gained probably benign
R4479:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4480:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4846:Psg18 UTSW 7 18350786 nonsense probably null
R4858:Psg18 UTSW 7 18353484 missense possibly damaging 0.49
R5010:Psg18 UTSW 7 18349354 missense probably damaging 1.00
R5225:Psg18 UTSW 7 18345949 missense probably damaging 1.00
R5450:Psg18 UTSW 7 18353425 missense probably benign 0.32
R5526:Psg18 UTSW 7 18349348 missense probably damaging 1.00
R5840:Psg18 UTSW 7 18346602 intron probably benign
R7164:Psg18 UTSW 7 18350937 missense possibly damaging 0.89
R7276:Psg18 UTSW 7 18345984 missense probably damaging 0.99
R7768:Psg18 UTSW 7 18346028 missense probably damaging 1.00
R8301:Psg18 UTSW 7 18353377 missense probably damaging 0.99
Z1176:Psg18 UTSW 7 18354787 missense probably benign 0.07
Z1177:Psg18 UTSW 7 18349115 missense probably benign 0.30
Z1177:Psg18 UTSW 7 18349198 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TACACGTGCAAGTACAGGGATG -3'
(R):5'- ACCTGCTCATTATTGGTGGC -3'

Sequencing Primer
(F):5'- CACGTGCAAGTACAGGGATGTATTTG -3'
(R):5'- GCTCATTATTGGTGGCTTCTC -3'
Posted On2018-05-04