Incidental Mutation 'R6409:Zc3h12d'
ID514781
Institutional Source Beutler Lab
Gene Symbol Zc3h12d
Ensembl Gene ENSMUSG00000039981
Gene Namezinc finger CCCH type containing 12D
SynonymsD730019B10Rik, TFL
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6409 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location7832470-7870396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7867318 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 284 (H284R)
Ref Sequence ENSEMBL: ENSMUSP00000040217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039484]
Predicted Effect probably benign
Transcript: ENSMUST00000039484
AA Change: H284R

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040217
Gene: ENSMUSG00000039981
AA Change: H284R

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 91 247 4e-67 PFAM
low complexity region 333 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 97% (32/33)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit disrupted regulation of excessive inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,262,071 probably benign Het
Aatk G T 11: 120,011,732 Q556K probably benign Het
Adgrf3 A G 5: 30,197,314 V572A probably damaging Het
Ahnak G A 19: 9,009,574 V2741M probably benign Het
Ascc3 T C 10: 50,845,580 V2043A probably benign Het
B3glct C T 5: 149,735,451 R239C probably benign Het
Cacna2d4 T A 6: 119,282,228 V626E probably damaging Het
Cfap54 T C 10: 92,967,492 N1563D probably benign Het
Duox2 G C 2: 122,284,667 H1110D probably damaging Het
Gm12794 C T 4: 101,940,677 Q91* probably null Het
Inppl1 A T 7: 101,828,961 F648I probably damaging Het
Mefv C A 16: 3,710,793 probably null Het
Ms4a4b T C 19: 11,461,360 probably null Het
Mtus2 T C 5: 148,077,615 V406A probably benign Het
Nup88 T C 11: 70,944,972 R554G probably null Het
Olfr1098 A T 2: 86,923,171 Y120* probably null Het
Olfr1425 C T 19: 12,074,747 probably benign Het
Olfr54 A G 11: 51,027,188 Y62C probably damaging Het
Pde10a A G 17: 8,949,438 D246G probably damaging Het
Pmm1 T C 15: 81,960,807 T9A probably benign Het
Psg18 T C 7: 18,353,521 M71V probably benign Het
Rapgef4 A G 2: 72,178,237 H253R probably benign Het
Rfc4 T C 16: 23,114,073 *371W probably null Het
Rgs18 T A 1: 144,775,193 K17* probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sertm1 T C 3: 54,899,367 Y79C probably benign Het
Sfrp1 T C 8: 23,417,378 I198T possibly damaging Het
Slc15a2 T A 16: 36,761,870 I254F probably benign Het
Slc29a4 A G 5: 142,712,071 D93G probably damaging Het
Smo T C 6: 29,736,114 L35S unknown Het
Tbc1d8 A G 1: 39,372,588 S1056P probably benign Het
Ttll9 A G 2: 152,999,341 D286G probably damaging Het
Vmn2r14 A G 5: 109,216,230 Y607H probably benign Het
Vps8 T A 16: 21,478,439 C564S probably benign Het
Zfp106 A T 2: 120,532,104 S79T probably damaging Het
Other mutations in Zc3h12d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Zc3h12d APN 10 7862467 missense probably damaging 1.00
IGL01013:Zc3h12d APN 10 7839956 missense probably damaging 1.00
IGL02090:Zc3h12d APN 10 7867332 missense probably benign 0.00
IGL02876:Zc3h12d APN 10 7862600 missense probably damaging 0.99
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R1942:Zc3h12d UTSW 10 7853313 missense probably damaging 1.00
R2290:Zc3h12d UTSW 10 7867459 missense probably benign 0.00
R2354:Zc3h12d UTSW 10 7867938 missense probably benign 0.00
R4816:Zc3h12d UTSW 10 7867947 missense probably damaging 1.00
R4932:Zc3h12d UTSW 10 7853250 missense probably damaging 0.99
R5191:Zc3h12d UTSW 10 7867818 missense possibly damaging 0.51
R5384:Zc3h12d UTSW 10 7853250 missense probably damaging 1.00
R5396:Zc3h12d UTSW 10 7866326 missense probably damaging 1.00
R6877:Zc3h12d UTSW 10 7839971 missense probably damaging 0.99
R6903:Zc3h12d UTSW 10 7867661 missense probably benign
R6967:Zc3h12d UTSW 10 7839880 missense probably damaging 1.00
R7312:Zc3h12d UTSW 10 7867581 missense probably benign 0.00
R7594:Zc3h12d UTSW 10 7862618 missense probably damaging 1.00
R7622:Zc3h12d UTSW 10 7867269 missense probably damaging 1.00
R7645:Zc3h12d UTSW 10 7867576 missense probably benign
R7769:Zc3h12d UTSW 10 7867626 missense probably benign 0.03
R7864:Zc3h12d UTSW 10 7839959 missense possibly damaging 0.83
R7947:Zc3h12d UTSW 10 7839959 missense possibly damaging 0.83
Z1177:Zc3h12d UTSW 10 7867808 missense not run
Predicted Primers PCR Primer
(F):5'- TTACTCAGCTGACCTTGGGG -3'
(R):5'- ATTCAAAGCTGCCAGGACCG -3'

Sequencing Primer
(F):5'- GGTTACAGAGCTCTGAGCAC -3'
(R):5'- CTGTTGTAGGACGGCTC -3'
Posted On2018-05-04