Incidental Mutation 'R6413:Rgs8'
ID514796
Institutional Source Beutler Lab
Gene Symbol Rgs8
Ensembl Gene ENSMUSG00000042671
Gene Nameregulator of G-protein signaling 8
Synonyms6530413N01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location153653025-153700323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 153692873 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 168 (D168V)
Ref Sequence ENSEMBL: ENSMUSP00000107446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041776] [ENSMUST00000111810] [ENSMUST00000111812] [ENSMUST00000111814] [ENSMUST00000111815] [ENSMUST00000124500] [ENSMUST00000147482] [ENSMUST00000147700] [ENSMUST00000152114]
Predicted Effect probably damaging
Transcript: ENSMUST00000041776
AA Change: D170V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045715
Gene: ENSMUSG00000042671
AA Change: D170V

DomainStartEndE-ValueType
RGS 56 172 1.83e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111810
AA Change: D170V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107441
Gene: ENSMUSG00000042671
AA Change: D170V

DomainStartEndE-ValueType
RGS 56 172 1.83e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111812
AA Change: D170V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107443
Gene: ENSMUSG00000042671
AA Change: D170V

DomainStartEndE-ValueType
RGS 56 172 1.83e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111814
AA Change: D168V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107445
Gene: ENSMUSG00000042671
AA Change: D168V

DomainStartEndE-ValueType
RGS 54 170 1.83e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111815
AA Change: D168V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107446
Gene: ENSMUSG00000042671
AA Change: D168V

DomainStartEndE-ValueType
RGS 54 170 1.83e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124500
SMART Domains Protein: ENSMUSP00000122518
Gene: ENSMUSG00000042671

DomainStartEndE-ValueType
Pfam:RGS 56 99 2.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147482
SMART Domains Protein: ENSMUSP00000118365
Gene: ENSMUSG00000042671

DomainStartEndE-ValueType
Pfam:RGS 54 115 6.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147700
SMART Domains Protein: ENSMUSP00000123565
Gene: ENSMUSG00000042671

DomainStartEndE-ValueType
Pfam:RGS 56 115 1.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152114
SMART Domains Protein: ENSMUSP00000121910
Gene: ENSMUSG00000042671

DomainStartEndE-ValueType
RGS 56 137 1.52e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187154
Meta Mutation Damage Score 0.7222 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulator of G protein signaling (RGS) family and encodes a protein with a single RGS domain. Regulator of G protein signaling (RGS) proteins are regulatory and structural components of G protein-coupled receptor complexes. They accelerate transit through the cycle of GTP binding and hydrolysis to GDP, thereby terminating signal transduction, but paradoxically, also accelerate receptor-stimulated activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal fertility and Purkinje cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Rgs8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02100:Rgs8 APN 1 153692723 critical splice acceptor site probably null
IGL02163:Rgs8 APN 1 153671765 missense possibly damaging 0.71
IGL02826:Rgs8 APN 1 153670799 missense probably damaging 1.00
IGL03345:Rgs8 APN 1 153692810 missense probably benign 0.34
R0561:Rgs8 UTSW 1 153665922 splice site probably null
R0801:Rgs8 UTSW 1 153670811 missense probably damaging 1.00
R3618:Rgs8 UTSW 1 153690996 missense probably null 0.35
R4058:Rgs8 UTSW 1 153690996 missense probably null 0.35
R4059:Rgs8 UTSW 1 153690996 missense probably null 0.35
R4877:Rgs8 UTSW 1 153692887 unclassified probably benign
R5070:Rgs8 UTSW 1 153665904 missense probably damaging 0.97
R5841:Rgs8 UTSW 1 153692828 missense probably damaging 1.00
R6028:Rgs8 UTSW 1 153690988 missense probably damaging 1.00
R7682:Rgs8 UTSW 1 153690922 missense probably damaging 1.00
X0028:Rgs8 UTSW 1 153670846 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGTGAGATGCTGCCGTTG -3'
(R):5'- TGGAAAAGCCCTTCATTCCC -3'

Sequencing Primer
(F):5'- TGCTGCCCAATAGGTGC -3'
(R):5'- GGAAAAGCCCTTCATTCCCTTGTC -3'
Posted On2018-05-04