Incidental Mutation 'R6413:Serpini2'
ID514800
Institutional Source Beutler Lab
Gene Symbol Serpini2
Ensembl Gene ENSMUSG00000034139
Gene Nameserine (or cysteine) peptidase inhibitor, clade I, member 2
Synonyms1810006A24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location75242370-75270078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75259614 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 112 (Y112C)
Ref Sequence ENSEMBL: ENSMUSP00000046943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039047]
Predicted Effect probably damaging
Transcript: ENSMUST00000039047
AA Change: Y112C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046943
Gene: ENSMUSG00000034139
AA Change: Y112C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 31 392 8.75e-130 SMART
Meta Mutation Damage Score 0.3535 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of a family of proteins that acts as inhibitors of serine proteases. These proteins function in the regulation of a variety of physiological processes, including coagulation, fibrinolysis, development, malignancy, and inflammation. Expression of the encoded protein may be downregulated during pancreatic carcinogenesis. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgene insertion/deletion encompassing this gene display pancreatic insufficiency characterized by progressive apoptosis of pancreatic acinar cells, postnatal growth retardation, immunological anomalies, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Serpini2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Serpini2 APN 3 75249242 missense probably damaging 1.00
IGL00736:Serpini2 APN 3 75267809 missense possibly damaging 0.70
IGL03398:Serpini2 APN 3 75259545 missense probably benign 0.00
R0271:Serpini2 UTSW 3 75246578 missense probably damaging 1.00
R0545:Serpini2 UTSW 3 75258138 missense probably benign 0.04
R2309:Serpini2 UTSW 3 75259690 missense probably damaging 0.99
R2435:Serpini2 UTSW 3 75258168 missense probably benign 0.00
R2886:Serpini2 UTSW 3 75259614 missense probably damaging 1.00
R5054:Serpini2 UTSW 3 75259477 missense probably damaging 1.00
R5151:Serpini2 UTSW 3 75246513 missense possibly damaging 0.93
R5554:Serpini2 UTSW 3 75267988 start gained probably benign
R5614:Serpini2 UTSW 3 75257707 intron probably benign
R6510:Serpini2 UTSW 3 75252568 missense probably damaging 0.97
R6688:Serpini2 UTSW 3 75259563 missense possibly damaging 0.88
R7178:Serpini2 UTSW 3 75258148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGCAATGGGAAAACATTC -3'
(R):5'- CCATGATTATCTATGTCTCAGCATG -3'

Sequencing Primer
(F):5'- TGGGAAAACATTCAGCCACTCTTTAC -3'
(R):5'- GTCTCAGCATGAAAAATTGGTGAC -3'
Posted On2018-05-04