Incidental Mutation 'R6413:Ankrd35'
ID514802
Institutional Source Beutler Lab
Gene Symbol Ankrd35
Ensembl Gene ENSMUSG00000038354
Gene Nameankyrin repeat domain 35
Synonyms4732436F15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location96670131-96691032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96684813 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 805 (K805R)
Ref Sequence ENSEMBL: ENSMUSP00000047244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048427] [ENSMUST00000122960]
Predicted Effect probably damaging
Transcript: ENSMUST00000048427
AA Change: K805R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047244
Gene: ENSMUSG00000038354
AA Change: K805R

DomainStartEndE-ValueType
ANK 53 82 4.03e-5 SMART
ANK 86 115 6.46e-4 SMART
ANK 119 148 4.36e-1 SMART
ANK 152 181 1.4e-4 SMART
ANK 185 214 2.25e-3 SMART
ANK 218 247 6.24e2 SMART
coiled coil region 294 339 N/A INTRINSIC
low complexity region 438 455 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
coiled coil region 606 653 N/A INTRINSIC
coiled coil region 729 799 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 847 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130429
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Ankrd35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Ankrd35 APN 3 96683034 splice site probably null
IGL00896:Ankrd35 APN 3 96684276 missense probably damaging 1.00
IGL01565:Ankrd35 APN 3 96684785 missense probably damaging 0.99
IGL01837:Ankrd35 APN 3 96680666 missense probably damaging 1.00
IGL02605:Ankrd35 APN 3 96681072 splice site probably null
IGL02819:Ankrd35 APN 3 96690208 missense possibly damaging 0.80
IGL02994:Ankrd35 APN 3 96682991 splice site probably benign
IGL03083:Ankrd35 APN 3 96684801 missense probably damaging 1.00
IGL03105:Ankrd35 APN 3 96684057 missense probably benign
FR4304:Ankrd35 UTSW 3 96683847 utr 3 prime probably benign
FR4342:Ankrd35 UTSW 3 96683515 frame shift probably null
FR4737:Ankrd35 UTSW 3 96683849 utr 3 prime probably benign
R0003:Ankrd35 UTSW 3 96684015 missense probably damaging 1.00
R0047:Ankrd35 UTSW 3 96684063 missense probably benign 0.00
R0551:Ankrd35 UTSW 3 96683960 missense probably benign 0.08
R1420:Ankrd35 UTSW 3 96684738 missense probably benign 0.13
R1455:Ankrd35 UTSW 3 96678155 missense probably damaging 1.00
R2201:Ankrd35 UTSW 3 96679248 missense possibly damaging 0.93
R3522:Ankrd35 UTSW 3 96685062 missense probably damaging 1.00
R3605:Ankrd35 UTSW 3 96682181 nonsense probably null
R4166:Ankrd35 UTSW 3 96679155 splice site probably null
R4651:Ankrd35 UTSW 3 96684027 missense probably benign 0.00
R4668:Ankrd35 UTSW 3 96679208 missense probably damaging 1.00
R4916:Ankrd35 UTSW 3 96684122 missense probably benign
R4921:Ankrd35 UTSW 3 96684824 missense possibly damaging 0.61
R4953:Ankrd35 UTSW 3 96683673 missense possibly damaging 0.56
R5180:Ankrd35 UTSW 3 96680473 missense probably damaging 1.00
R5583:Ankrd35 UTSW 3 96684903 missense probably damaging 1.00
R5604:Ankrd35 UTSW 3 96684899 missense probably benign 0.02
R5613:Ankrd35 UTSW 3 96683018 missense possibly damaging 0.76
R6165:Ankrd35 UTSW 3 96683307 missense possibly damaging 0.93
R6711:Ankrd35 UTSW 3 96683468 nonsense probably null
R6834:Ankrd35 UTSW 3 96683283 missense possibly damaging 0.68
R6841:Ankrd35 UTSW 3 96670426 missense probably damaging 1.00
R7028:Ankrd35 UTSW 3 96683334 missense possibly damaging 0.92
R7396:Ankrd35 UTSW 3 96683497 missense probably damaging 1.00
R7425:Ankrd35 UTSW 3 96684788 missense not run
R7815:Ankrd35 UTSW 3 96684801 missense probably damaging 1.00
R7887:Ankrd35 UTSW 3 96684900 missense probably damaging 1.00
R8103:Ankrd35 UTSW 3 96679681 missense possibly damaging 0.93
R8318:Ankrd35 UTSW 3 96684722 missense probably damaging 1.00
Z1177:Ankrd35 UTSW 3 96683770 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAGGCACCTTGAGGCTCAAC -3'
(R):5'- TGTCCCGCAATCGAGTCATTTC -3'

Sequencing Primer
(F):5'- ACCTTGAGGCTCAACGGGTG -3'
(R):5'- ATCGAGTCATTTCCCGACAGG -3'
Posted On2018-05-04