Incidental Mutation 'R6413:Sh2b3'
ID514810
Institutional Source Beutler Lab
Gene Symbol Sh2b3
Ensembl Gene ENSMUSG00000042594
Gene NameSH2B adaptor protein 3
SynonymsLnk
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R6413 (G1)
Quality Score97.0078
Status Validated
Chromosome5
Chromosomal Location121815488-121837646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121828923 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 43 (Y43H)
Ref Sequence ENSEMBL: ENSMUSP00000142666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040308] [ENSMUST00000086310] [ENSMUST00000118580] [ENSMUST00000122426] [ENSMUST00000136960] [ENSMUST00000137682] [ENSMUST00000197892]
Predicted Effect probably damaging
Transcript: ENSMUST00000040308
AA Change: Y43H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041611
Gene: ENSMUSG00000042594
AA Change: Y43H

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 23 76 1.1e-20 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086310
AA Change: Y43H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083490
Gene: ENSMUSG00000042594
AA Change: Y43H

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-22 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118580
AA Change: Y43H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113808
Gene: ENSMUSG00000042594
AA Change: Y43H

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 4.1e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 324 409 3.53e-19 SMART
low complexity region 502 515 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122426
AA Change: Y43H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113926
Gene: ENSMUSG00000042594
AA Change: Y43H

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-22 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136960
AA Change: Y43H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119086
Gene: ENSMUSG00000042594
AA Change: Y43H

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2.4e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137682
AA Change: Y43H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118523
Gene: ENSMUSG00000042594
AA Change: Y43H

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197892
AA Change: Y43H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142666
Gene: ENSMUSG00000042594
AA Change: Y43H

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 6.3e-20 PFAM
low complexity region 114 128 N/A INTRINSIC
Blast:PH 168 250 3e-53 BLAST
PDB:1V5M|A 171 250 1e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000198161
Meta Mutation Damage Score 0.4400 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a member of the SH2B family of adapter proteins that play an important role in T cell receptor signaling. This gene is preferentially expressed in hematopoietic stem cells, hematopoietic progenitors, pre and immature B cells, as well as megakaryocytes and mastocytes. In hematopoietic stem cells, the encoded protein is a key regulator of self-renewal, proliferation and apoptosis. Mice lacking the encoded protein exhibit pre and immature B cell expansion in spleen and the bone marrow. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe perturbations in hematopoiesis, splenomegaly, and abnormal lymphoid and myeloid homeostasis. Mice homozygous for a different knock-out allele display altered mobility of hematopoietic stem/progenitor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Sh2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02283:Sh2b3 APN 5 121818655 missense probably benign 0.09
IGL02328:Sh2b3 APN 5 121817859 missense probably benign 0.00
PIT4449001:Sh2b3 UTSW 5 121828679 missense possibly damaging 0.95
R0164:Sh2b3 UTSW 5 121829037 missense probably damaging 0.97
R0164:Sh2b3 UTSW 5 121829037 missense probably damaging 0.97
R2898:Sh2b3 UTSW 5 121829048 start codon destroyed probably null 0.93
R4374:Sh2b3 UTSW 5 121828486 unclassified probably benign
R4688:Sh2b3 UTSW 5 121818634 missense probably benign 0.23
R4822:Sh2b3 UTSW 5 121828555 unclassified probably benign
R5743:Sh2b3 UTSW 5 121828457 missense probably damaging 1.00
R5888:Sh2b3 UTSW 5 121829021 missense possibly damaging 0.73
R6130:Sh2b3 UTSW 5 121815563 splice site probably null
R6167:Sh2b3 UTSW 5 121828355 splice site probably null
R7499:Sh2b3 UTSW 5 121818473 missense probably damaging 0.97
R7615:Sh2b3 UTSW 5 121818700 missense probably benign 0.00
R7672:Sh2b3 UTSW 5 121818759 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTGGTGTCACTGGTAGCCC -3'
(R):5'- TCTGACTTGTCTTACAGCCCGG -3'

Sequencing Primer
(F):5'- GTCCTCGGAGCTGCGTG -3'
(R):5'- GCTCTCCACCATGAACG -3'
Posted On2018-05-04