Incidental Mutation 'R6413:Cyp3a44'
ID514812
Institutional Source Beutler Lab
Gene Symbol Cyp3a44
Ensembl Gene ENSMUSG00000054417
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 44
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145773983-145805874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145794444 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 182 (D182V)
Ref Sequence ENSEMBL: ENSMUSP00000069932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067479]
Predicted Effect probably damaging
Transcript: ENSMUST00000067479
AA Change: D182V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069932
Gene: ENSMUSG00000054417
AA Change: D182V

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:p450 38 494 2.4e-133 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Cyp3a44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Cyp3a44 APN 5 145774347 makesense probably null
IGL00972:Cyp3a44 APN 5 145779724 missense possibly damaging 0.84
IGL01062:Cyp3a44 APN 5 145794339 missense possibly damaging 0.88
IGL01072:Cyp3a44 APN 5 145791628 missense probably benign 0.01
IGL01515:Cyp3a44 APN 5 145799418 nonsense probably null
IGL01738:Cyp3a44 APN 5 145794935 missense probably damaging 1.00
IGL01869:Cyp3a44 APN 5 145790686 missense probably damaging 0.99
IGL02269:Cyp3a44 APN 5 145805737 missense probably benign 0.23
IGL02284:Cyp3a44 APN 5 145788369 missense possibly damaging 0.91
IGL02479:Cyp3a44 APN 5 145790667 missense probably benign 0.01
IGL02480:Cyp3a44 APN 5 145794905 missense possibly damaging 0.93
IGL02506:Cyp3a44 APN 5 145799388 missense probably damaging 1.00
IGL02957:Cyp3a44 APN 5 145779662 nonsense probably null
IGL02978:Cyp3a44 APN 5 145788398 missense probably damaging 0.98
R0427:Cyp3a44 UTSW 5 145779602 missense possibly damaging 0.85
R1240:Cyp3a44 UTSW 5 145774440 missense probably benign 0.02
R1247:Cyp3a44 UTSW 5 145791667 missense probably damaging 1.00
R1657:Cyp3a44 UTSW 5 145779743 missense probably damaging 0.99
R2096:Cyp3a44 UTSW 5 145788405 missense probably damaging 1.00
R2156:Cyp3a44 UTSW 5 145803670 nonsense probably null
R2412:Cyp3a44 UTSW 5 145779579 nonsense probably null
R4817:Cyp3a44 UTSW 5 145803755 missense possibly damaging 0.64
R4884:Cyp3a44 UTSW 5 145777982 missense probably damaging 1.00
R5266:Cyp3a44 UTSW 5 145794397 missense possibly damaging 0.66
R5301:Cyp3a44 UTSW 5 145788516 missense probably damaging 0.99
R5463:Cyp3a44 UTSW 5 145803744 missense probably benign 0.00
R5625:Cyp3a44 UTSW 5 145779566 missense possibly damaging 0.74
R5635:Cyp3a44 UTSW 5 145801314 missense possibly damaging 0.90
R5924:Cyp3a44 UTSW 5 145794327 missense possibly damaging 0.54
R5964:Cyp3a44 UTSW 5 145788467 missense possibly damaging 0.95
R5988:Cyp3a44 UTSW 5 145794918 missense probably damaging 1.00
R6011:Cyp3a44 UTSW 5 145801274 critical splice donor site probably null
R6032:Cyp3a44 UTSW 5 145777946 missense probably damaging 1.00
R6032:Cyp3a44 UTSW 5 145777946 missense probably damaging 1.00
R6579:Cyp3a44 UTSW 5 145790706 missense probably damaging 0.99
R6587:Cyp3a44 UTSW 5 145805759 missense probably benign 0.23
R6709:Cyp3a44 UTSW 5 145778092 splice site probably null
R6727:Cyp3a44 UTSW 5 145794971 nonsense probably null
R6825:Cyp3a44 UTSW 5 145779586 missense probably damaging 1.00
R7142:Cyp3a44 UTSW 5 145777961 missense probably benign 0.24
R7352:Cyp3a44 UTSW 5 145803688 missense probably benign 0.01
R7921:Cyp3a44 UTSW 5 145791688 missense probably damaging 1.00
R7962:Cyp3a44 UTSW 5 145801325 missense probably benign
R8099:Cyp3a44 UTSW 5 145788402 missense probably benign 0.12
R8240:Cyp3a44 UTSW 5 145788447 missense probably damaging 0.99
Z1176:Cyp3a44 UTSW 5 145791664 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCACTACAGCTGATCATTTGG -3'
(R):5'- ACATGGTCCAGGTGCTTGTC -3'

Sequencing Primer
(F):5'- CAGCTGATCATTTGGAGAAATTGAG -3'
(R):5'- ATGGTCCAGGTGCTTGTCCTTTC -3'
Posted On2018-05-04