Incidental Mutation 'R6413:Numa1'
ID514817
Institutional Source Beutler Lab
Gene Symbol Numa1
Ensembl Gene ENSMUSG00000066306
Gene Namenuclear mitotic apparatus protein 1
Synonyms6720401E04Rik
MMRRC Submission
Accession Numbers

Genbank: NM_133947.3; Ensembl: ENSMUST00000084852

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location101934111-102014964 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 101990571 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084852] [ENSMUST00000209639] [ENSMUST00000210475] [ENSMUST00000210679] [ENSMUST00000211272]
Predicted Effect probably null
Transcript: ENSMUST00000084852
SMART Domains Protein: ENSMUSP00000081912
Gene: ENSMUSG00000066306

DomainStartEndE-ValueType
low complexity region 187 201 N/A INTRINSIC
coiled coil region 211 249 N/A INTRINSIC
coiled coil region 274 818 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
internal_repeat_1 910 933 6.03e-6 PROSPERO
internal_repeat_2 911 951 2.35e-5 PROSPERO
low complexity region 979 992 N/A INTRINSIC
low complexity region 1002 1018 N/A INTRINSIC
low complexity region 1063 1081 N/A INTRINSIC
internal_repeat_5 1094 1116 4.63e-5 PROSPERO
low complexity region 1130 1138 N/A INTRINSIC
low complexity region 1220 1233 N/A INTRINSIC
low complexity region 1271 1289 N/A INTRINSIC
low complexity region 1364 1374 N/A INTRINSIC
coiled coil region 1464 1681 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
internal_repeat_3 1718 1755 4.63e-5 PROSPERO
internal_repeat_4 1777 1819 4.63e-5 PROSPERO
internal_repeat_3 1800 1842 4.63e-5 PROSPERO
internal_repeat_4 1811 1854 4.63e-5 PROSPERO
low complexity region 1859 1875 N/A INTRINSIC
PDB:3RO2|B 1881 1908 3e-13 PDB
internal_repeat_2 1938 1977 2.35e-5 PROSPERO
internal_repeat_5 1973 1995 4.63e-5 PROSPERO
internal_repeat_1 2020 2043 6.03e-6 PROSPERO
low complexity region 2073 2085 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209639
Predicted Effect probably null
Transcript: ENSMUST00000210475
Predicted Effect probably null
Transcript: ENSMUST00000210679
Predicted Effect probably null
Transcript: ENSMUST00000211272
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out or hypomorphic allele exhibit embryonic lethality by E9.5. [provided by MGI curators]
Allele List at MGI

All alleles(97) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(94)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Numa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Numa1 APN 7 102013286 missense possibly damaging 0.95
IGL00819:Numa1 APN 7 101992710 missense possibly damaging 0.90
IGL01103:Numa1 APN 7 102001571 missense probably benign 0.01
IGL01153:Numa1 APN 7 101994744 missense probably damaging 1.00
IGL01954:Numa1 APN 7 101996093 nonsense probably null
IGL02114:Numa1 APN 7 102011876 unclassified probably benign
IGL02245:Numa1 APN 7 102000394 missense probably benign 0.02
IGL02259:Numa1 APN 7 101987748 missense possibly damaging 0.93
IGL02313:Numa1 APN 7 102000232 nonsense probably null
IGL02316:Numa1 APN 7 102001370 missense probably damaging 1.00
IGL02386:Numa1 APN 7 102007532 missense probably benign 0.00
IGL02517:Numa1 APN 7 102012009 missense probably benign 0.01
IGL02529:Numa1 APN 7 101999953 splice site probably null
IGL02664:Numa1 APN 7 101998902 missense possibly damaging 0.83
IGL02721:Numa1 APN 7 101999911 missense probably benign 0.01
IGL02816:Numa1 APN 7 101996100 missense probably damaging 1.00
IGL03126:Numa1 APN 7 102000667 nonsense probably null
meltdown UTSW 7 101990571 critical splice acceptor site probably null
1mM(1):Numa1 UTSW 7 101994715 missense probably benign 0.06
PIT4651001:Numa1 UTSW 7 102013934 missense probably damaging 0.97
R0047:Numa1 UTSW 7 102009453 missense probably damaging 1.00
R0047:Numa1 UTSW 7 102009453 missense probably damaging 1.00
R0548:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R0554:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R0592:Numa1 UTSW 7 102013897 missense probably benign
R0669:Numa1 UTSW 7 101999677 missense probably benign
R0856:Numa1 UTSW 7 101998948 missense probably damaging 1.00
R1072:Numa1 UTSW 7 102001150 splice site probably null
R1776:Numa1 UTSW 7 102011050 missense probably damaging 1.00
R1898:Numa1 UTSW 7 101992720 critical splice donor site probably null
R1969:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R1970:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R1971:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R2180:Numa1 UTSW 7 101999990 missense probably benign 0.00
R2256:Numa1 UTSW 7 102000791 missense probably damaging 0.99
R2257:Numa1 UTSW 7 102000791 missense probably damaging 0.99
R2508:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R2958:Numa1 UTSW 7 102009495 missense possibly damaging 0.92
R4210:Numa1 UTSW 7 102009738 missense probably damaging 1.00
R4211:Numa1 UTSW 7 102009738 missense probably damaging 1.00
R4643:Numa1 UTSW 7 102000665 splice site probably null
R4783:Numa1 UTSW 7 102013566 missense probably damaging 1.00
R4823:Numa1 UTSW 7 101996037 missense probably damaging 1.00
R4908:Numa1 UTSW 7 102012805 missense probably damaging 1.00
R4934:Numa1 UTSW 7 102010857 missense probably benign 0.32
R4981:Numa1 UTSW 7 101992674 missense probably damaging 1.00
R5120:Numa1 UTSW 7 101977437 missense probably damaging 0.99
R5122:Numa1 UTSW 7 102013769 missense probably damaging 1.00
R5210:Numa1 UTSW 7 101999981 missense probably benign 0.03
R5230:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R5547:Numa1 UTSW 7 102013930 missense probably damaging 1.00
R5861:Numa1 UTSW 7 102009287 splice site probably null
R6006:Numa1 UTSW 7 101992719 critical splice donor site probably null
R6031:Numa1 UTSW 7 102012012 missense possibly damaging 0.86
R6031:Numa1 UTSW 7 102012012 missense possibly damaging 0.86
R6295:Numa1 UTSW 7 102000767 missense probably benign 0.03
R6322:Numa1 UTSW 7 102000920 missense probably damaging 1.00
R6786:Numa1 UTSW 7 101992638 missense probably benign 0.05
R7218:Numa1 UTSW 7 102000910 missense probably benign 0.02
R7312:Numa1 UTSW 7 101990599 missense possibly damaging 0.92
R7374:Numa1 UTSW 7 102009128 missense probably benign 0.00
R7626:Numa1 UTSW 7 101999423 missense probably benign 0.42
R7769:Numa1 UTSW 7 101999000 missense possibly damaging 0.77
R7830:Numa1 UTSW 7 101999285 missense probably benign 0.03
R7886:Numa1 UTSW 7 102013865 missense probably benign 0.27
R7935:Numa1 UTSW 7 102002331 missense probably damaging 0.96
R8134:Numa1 UTSW 7 102001627 missense probably benign 0.14
R8143:Numa1 UTSW 7 101999684 missense possibly damaging 0.82
R8217:Numa1 UTSW 7 101992669 missense possibly damaging 0.66
R8263:Numa1 UTSW 7 101999284 missense probably benign 0.03
RF013:Numa1 UTSW 7 101999780 missense probably damaging 0.99
Z1088:Numa1 UTSW 7 101998331 missense probably damaging 0.99
Z1088:Numa1 UTSW 7 101998402 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AAGTCAGCATTTCTTACCCGCC -3'
(R):5'- TTAACTCAAGACCCAGGGAGG -3'

Sequencing Primer
(F):5'- GCCACACATTTTCATCAGAGTAAAG -3'
(R):5'- CAAGACCCAGGGAGGCTGAC -3'
Posted On2018-05-04