Incidental Mutation 'R6413:Cenpt'
ID514819
Institutional Source Beutler Lab
Gene Symbol Cenpt
Ensembl Gene ENSMUSG00000036672
Gene Namecentromere protein T
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105844673-105853278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105846341 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 373 (P373S)
Ref Sequence ENSEMBL: ENSMUSP00000038188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034365] [ENSMUST00000040776] [ENSMUST00000212431] [ENSMUST00000212552] [ENSMUST00000212566] [ENSMUST00000212839]
Predicted Effect probably benign
Transcript: ENSMUST00000034365
SMART Domains Protein: ENSMUSP00000034365
Gene: ENSMUSG00000031893

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 98 209 3.5e-33 PFAM
coiled coil region 304 342 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000040776
AA Change: P373S

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038188
Gene: ENSMUSG00000036672
AA Change: P373S

DomainStartEndE-ValueType
Pfam:CENP-T_N 1 374 4.2e-174 PFAM
Pfam:CENP-T_C 404 507 5.4e-36 PFAM
Pfam:CENP-S 424 479 3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212357
Predicted Effect probably benign
Transcript: ENSMUST00000212431
Predicted Effect probably benign
Transcript: ENSMUST00000212552
Predicted Effect probably benign
Transcript: ENSMUST00000212566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212803
Predicted Effect probably benign
Transcript: ENSMUST00000212839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212873
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPT is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Cenpt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Cenpt APN 8 105846665 missense possibly damaging 0.52
IGL01970:Cenpt APN 8 105845116 missense probably damaging 1.00
IGL03141:Cenpt APN 8 105851941 missense probably damaging 0.99
IGL03403:Cenpt APN 8 105849665 nonsense probably null
R0089:Cenpt UTSW 8 105846368 missense probably benign 0.00
R0508:Cenpt UTSW 8 105849515 missense possibly damaging 0.81
R0648:Cenpt UTSW 8 105844960 missense probably damaging 0.99
R1460:Cenpt UTSW 8 105848888 missense probably damaging 1.00
R1839:Cenpt UTSW 8 105849014 missense possibly damaging 0.95
R4117:Cenpt UTSW 8 105849700 missense probably benign
R4732:Cenpt UTSW 8 105847136 missense probably benign 0.00
R4733:Cenpt UTSW 8 105847136 missense probably benign 0.00
R6246:Cenpt UTSW 8 105849259 missense possibly damaging 0.95
R6582:Cenpt UTSW 8 105849201 nonsense probably null
R7299:Cenpt UTSW 8 105849904 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTACACATCTTGGGTCAGG -3'
(R):5'- ACAGAAGAGAATTTGCCCCG -3'

Sequencing Primer
(F):5'- GTCAGGCACCAGGACGG -3'
(R):5'- AACTGGTAGTTTCAGGGGCCAC -3'
Posted On2018-05-04