Incidental Mutation 'R6413:Ankdd1a'
ID514821
Institutional Source Beutler Lab
Gene Symbol Ankdd1a
Ensembl Gene ENSMUSG00000066510
Gene Nameankyrin repeat and death domain containing 1A
SynonymsLOC384945
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location65488470-65520193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65510372 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 133 (V133I)
Ref Sequence ENSEMBL: ENSMUSP00000150130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061766] [ENSMUST00000217646]
Predicted Effect probably benign
Transcript: ENSMUST00000061766
AA Change: V123I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057040
Gene: ENSMUSG00000066510
AA Change: V123I

DomainStartEndE-ValueType
ANK 4 33 1.31e3 SMART
ANK 37 66 2.1e-3 SMART
ANK 70 99 6.26e-2 SMART
ANK 103 132 8.72e-1 SMART
ANK 138 167 5.09e-2 SMART
ANK 171 200 4.03e-5 SMART
ANK 204 233 5.32e-5 SMART
ANK 237 268 8.72e-1 SMART
ANK 270 299 8.99e-3 SMART
ANK 303 332 1.23e0 SMART
ANK 336 364 1.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217646
AA Change: V133I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Ankdd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Ankdd1a APN 9 65508702 missense probably damaging 1.00
IGL01372:Ankdd1a APN 9 65504139 missense probably damaging 1.00
IGL01932:Ankdd1a APN 9 65507611 splice site probably benign
IGL02150:Ankdd1a APN 9 65512719 missense probably damaging 1.00
IGL03243:Ankdd1a APN 9 65501470 missense probably benign 0.28
PIT4618001:Ankdd1a UTSW 9 65507650 missense possibly damaging 0.76
R0137:Ankdd1a UTSW 9 65510328 missense probably null 0.26
R0302:Ankdd1a UTSW 9 65509642 splice site probably benign
R0980:Ankdd1a UTSW 9 65516971 missense probably damaging 1.00
R1832:Ankdd1a UTSW 9 65504489 critical splice donor site probably null
R3887:Ankdd1a UTSW 9 65502248 missense probably damaging 1.00
R4470:Ankdd1a UTSW 9 65503509 missense probably damaging 1.00
R4471:Ankdd1a UTSW 9 65503509 missense probably damaging 1.00
R5326:Ankdd1a UTSW 9 65504190 critical splice acceptor site probably null
R5394:Ankdd1a UTSW 9 65505214 missense probably benign 0.12
R5542:Ankdd1a UTSW 9 65504190 critical splice acceptor site probably null
R5594:Ankdd1a UTSW 9 65502241 missense probably damaging 1.00
R5933:Ankdd1a UTSW 9 65509696 missense probably benign 0.11
R6217:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6294:Ankdd1a UTSW 9 65520164 missense probably benign 0.12
R6300:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6301:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6305:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6306:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6307:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6312:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6313:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6314:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6431:Ankdd1a UTSW 9 65516938 missense possibly damaging 0.92
R6477:Ankdd1a UTSW 9 65502212 missense probably benign 0.10
R6991:Ankdd1a UTSW 9 65508675 missense probably benign 0.22
R7260:Ankdd1a UTSW 9 65504552 missense probably damaging 0.96
R7586:Ankdd1a UTSW 9 65502184 critical splice donor site probably null
X0064:Ankdd1a UTSW 9 65503453 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGACTCTCAAGGTAGAGTGC -3'
(R):5'- TCTGGCATCCTGATTGACAGC -3'

Sequencing Primer
(F):5'- AGAATGCACTCCAGATGTGC -3'
(R):5'- GCATCCTGATTGACAGCACTGTTG -3'
Posted On2018-05-04