Incidental Mutation 'R6413:E030025P04Rik'
ID514823
Institutional Source Beutler Lab
Gene Symbol E030025P04Rik
Ensembl Gene ENSMUSG00000078605
Gene NameRIKEN cDNA E030025P04 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location109139291-109144369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109139599 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 154 (Y154C)
Ref Sequence ENSEMBL: ENSMUSP00000102321 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000106710
AA Change: Y154C
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in E030025P04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:E030025P04Rik APN 11 109143888 missense unknown
IGL02709:E030025P04Rik APN 11 109139498 utr 3 prime probably benign
Tipper UTSW 11 109139599 missense unknown
K3955:E030025P04Rik UTSW 11 109143952 missense unknown
R1842:E030025P04Rik UTSW 11 109139570 missense unknown
R1854:E030025P04Rik UTSW 11 109143918 missense unknown
R2382:E030025P04Rik UTSW 11 109144054 nonsense probably null
R6870:E030025P04Rik UTSW 11 109140167 missense unknown
Z1176:E030025P04Rik UTSW 11 109143971 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTGTTACCTTGCCCAACAGTG -3'
(R):5'- CAGGCTGACACAGTTAGAGC -3'

Sequencing Primer
(F):5'- CTCATGGATAAGACAGTGCACTTTGG -3'
(R):5'- GCTGACACAGTTAGAGCCTTAG -3'
Posted On2018-05-04