Incidental Mutation 'R6413:Ccnt1'
ID514830
Institutional Source Beutler Lab
Gene Symbol Ccnt1
Ensembl Gene ENSMUSG00000011960
Gene Namecyclin T1
Synonyms2810478G24Rik, CycT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location98538689-98570923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98543969 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 473 (S473P)
Ref Sequence ENSEMBL: ENSMUSP00000126874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012104] [ENSMUST00000168928] [ENSMUST00000169707]
Predicted Effect probably benign
Transcript: ENSMUST00000012104
AA Change: S473P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000012104
Gene: ENSMUSG00000011960
AA Change: S473P

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
SCOP:d1jkw_2 152 257 1e-24 SMART
Blast:CYCLIN 155 243 2e-54 BLAST
low complexity region 308 326 N/A INTRINSIC
coiled coil region 388 419 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
low complexity region 706 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164565
Predicted Effect probably benign
Transcript: ENSMUST00000168928
SMART Domains Protein: ENSMUSP00000130286
Gene: ENSMUSG00000011960

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
Blast:CYCLIN 155 182 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169674
Predicted Effect probably benign
Transcript: ENSMUST00000169707
AA Change: S473P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000126874
Gene: ENSMUSG00000011960
AA Change: S473P

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
SCOP:d1jkw_2 152 257 1e-24 SMART
Blast:CYCLIN 155 243 2e-54 BLAST
low complexity region 308 326 N/A INTRINSIC
coiled coil region 388 419 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
low complexity region 706 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170452
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the highly conserved cyclin C subfamily. The encoded protein tightly associates with cyclin-dependent kinase 9, and is a major subunit of positive transcription elongation factor b (p-TEFb). In humans, there are multiple forms of positive transcription elongation factor b, which may include one of several different cyclins along with cyclin-dependent kinase 9. The complex containing the encoded cyclin and cyclin-dependent kinase 9 acts as a cofactor of human immunodeficiency virus type 1 (HIV-1) Tat protein, and is both necessary and sufficient for full activation of viral transcription. This cyclin and its kinase partner are also involved in triggering transcript elongation through phosphorylation of the carboxy-terminal domain of the largest RNA polymerase II subunit. Overexpression of this gene is implicated in tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Ccnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ccnt1 APN 15 98565109 missense possibly damaging 0.75
IGL00900:Ccnt1 APN 15 98554633 missense probably damaging 1.00
IGL01798:Ccnt1 APN 15 98544241 missense probably benign 0.00
IGL02126:Ccnt1 APN 15 98567603 missense probably damaging 1.00
IGL02341:Ccnt1 APN 15 98546783 missense possibly damaging 0.92
Lifecycle UTSW 15 98565124 nonsense probably null
R0049:Ccnt1 UTSW 15 98565079 missense probably benign 0.05
R0049:Ccnt1 UTSW 15 98565079 missense probably benign 0.05
R1116:Ccnt1 UTSW 15 98544338 missense probably damaging 1.00
R2063:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2065:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2066:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2068:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2180:Ccnt1 UTSW 15 98543600 missense possibly damaging 0.74
R3917:Ccnt1 UTSW 15 98544059 missense probably benign 0.00
R4805:Ccnt1 UTSW 15 98544308 missense probably benign 0.00
R4830:Ccnt1 UTSW 15 98543451 missense probably damaging 1.00
R4836:Ccnt1 UTSW 15 98567563 missense probably damaging 0.96
R5320:Ccnt1 UTSW 15 98544243 missense probably benign 0.35
R5740:Ccnt1 UTSW 15 98544500 missense probably benign 0.01
R5870:Ccnt1 UTSW 15 98543513 nonsense probably null
R6074:Ccnt1 UTSW 15 98543324 missense probably damaging 1.00
R6610:Ccnt1 UTSW 15 98565101 missense probably damaging 1.00
R7260:Ccnt1 UTSW 15 98565124 nonsense probably null
R7752:Ccnt1 UTSW 15 98543916 missense probably benign 0.00
R7901:Ccnt1 UTSW 15 98543916 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGGACAAGCTGTAGGTTTTG -3'
(R):5'- AGTATGCGTATGCTGCCCAG -3'

Sequencing Primer
(F):5'- CGGCTGGCAGCTGTAAGTG -3'
(R):5'- GCGTATGCTGCCCAGAATCTC -3'
Posted On2018-05-04