Incidental Mutation 'R6413:Amdhd2'
ID514832
Institutional Source Beutler Lab
Gene Symbol Amdhd2
Ensembl Gene ENSMUSG00000036820
Gene Nameamidohydrolase domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24155833-24163766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24158316 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 208 (S208P)
Ref Sequence ENSEMBL: ENSMUSP00000036141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040735] [ENSMUST00000129523]
Predicted Effect probably damaging
Transcript: ENSMUST00000040735
AA Change: S208P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036141
Gene: ENSMUSG00000036820
AA Change: S208P

DomainStartEndE-ValueType
Pfam:Amidohydro_1 62 401 7.2e-18 PFAM
Pfam:Amidohydro_3 327 404 5.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129523
SMART Domains Protein: ENSMUSP00000120520
Gene: ENSMUSG00000036820

DomainStartEndE-ValueType
Pfam:Amidohydro_5 1 71 1.5e-7 PFAM
Pfam:Amidohydro_4 22 176 2.5e-9 PFAM
Pfam:Amidohydro_1 27 134 2.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132944
Predicted Effect probably benign
Transcript: ENSMUST00000138685
SMART Domains Protein: ENSMUSP00000122523
Gene: ENSMUSG00000036820

DomainStartEndE-ValueType
Pfam:Amidohydro_1 5 57 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Amdhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Amdhd2 APN 17 24163600 missense probably benign 0.38
IGL01868:Amdhd2 APN 17 24157530 missense probably damaging 1.00
IGL02889:Amdhd2 APN 17 24157787 missense probably damaging 1.00
IGL03127:Amdhd2 APN 17 24157738 critical splice donor site probably null
R0619:Amdhd2 UTSW 17 24156588 missense possibly damaging 0.65
R0759:Amdhd2 UTSW 17 24161613 missense probably benign 0.02
R0970:Amdhd2 UTSW 17 24156570 critical splice donor site probably null
R1657:Amdhd2 UTSW 17 24156055 missense probably damaging 1.00
R1929:Amdhd2 UTSW 17 24157886 unclassified probably null
R2080:Amdhd2 UTSW 17 24156604 missense probably benign 0.00
R2127:Amdhd2 UTSW 17 24158308 critical splice donor site probably null
R2871:Amdhd2 UTSW 17 24157855 unclassified probably benign
R4419:Amdhd2 UTSW 17 24158678 missense probably benign 0.31
R5681:Amdhd2 UTSW 17 24156040 missense probably damaging 1.00
R6315:Amdhd2 UTSW 17 24158356 missense probably benign 0.00
R7402:Amdhd2 UTSW 17 24161683 missense
R8276:Amdhd2 UTSW 17 24163600 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACAGGCAACATGGCATTGAAG -3'
(R):5'- TGCCTGCTAGAACTACCTCTG -3'

Sequencing Primer
(F):5'- CAACATGGCATTGAAGAGGTG -3'
(R):5'- ACTTGGAGGGCCCATTCATCAG -3'
Posted On2018-05-04