Incidental Mutation 'R6413:Dtna'
ID 514834
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Name dystrobrevin alpha
Synonyms a-DB-1, A0, alpha-dystrobrevin, 2210407P21Rik, 87K protein, Dtn, adbn
MMRRC Submission 044555-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R6413 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 23548192-23792772 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23755071 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 464 (D464E)
Ref Sequence ENSEMBL: ENSMUSP00000152288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115832] [ENSMUST00000220904] [ENSMUST00000221880]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000115832
AA Change: D407E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302
AA Change: D407E

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220904
AA Change: D464E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221880
AA Change: D464E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.0677 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,624,647 (GRCm39) probably benign Het
Agtpbp1 A G 13: 59,647,834 (GRCm39) V662A possibly damaging Het
Ambra1 T G 2: 91,599,429 (GRCm39) V183G possibly damaging Het
Amdhd2 A G 17: 24,377,290 (GRCm39) S208P probably damaging Het
Ankdd1a C T 9: 65,417,654 (GRCm39) V133I probably benign Het
Ankrd35 A G 3: 96,592,129 (GRCm39) K805R probably damaging Het
Arhgap28 T C 17: 68,182,583 (GRCm39) Q270R probably benign Het
Cabp2 G A 19: 4,135,698 (GRCm39) probably null Het
Ccnt1 A G 15: 98,441,850 (GRCm39) S473P probably benign Het
Cenpt G A 8: 106,572,973 (GRCm39) P373S possibly damaging Het
Cyp3a44 T A 5: 145,731,254 (GRCm39) D182V probably damaging Het
Ddx54 A G 5: 120,765,127 (GRCm39) T799A probably benign Het
E030025P04Rik T C 11: 109,030,425 (GRCm39) Y154C unknown Het
Ephb2 C A 4: 136,498,433 (GRCm39) E215D probably benign Het
Eya4 T C 10: 22,992,724 (GRCm39) D445G probably damaging Het
Flg2 A T 3: 93,127,683 (GRCm39) L2198F unknown Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Klhl22 T C 16: 17,607,181 (GRCm39) F496L probably benign Het
Numa1 A T 7: 101,639,778 (GRCm39) probably null Het
Papola T C 12: 105,772,763 (GRCm39) probably benign Het
Phldb1 T C 9: 44,607,440 (GRCm39) E1255G probably damaging Het
Rgs8 A T 1: 153,568,619 (GRCm39) D168V probably damaging Het
Rlf A G 4: 121,004,522 (GRCm39) V1486A probably damaging Het
Rpa2 G T 4: 132,501,156 (GRCm39) A118S probably benign Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Serpina1f T A 12: 103,659,953 (GRCm39) I110F probably damaging Het
Serpini2 T C 3: 75,166,921 (GRCm39) Y112C probably damaging Het
Sh2b3 A G 5: 121,966,986 (GRCm39) Y43H probably damaging Het
Shank2 A G 7: 143,963,955 (GRCm39) E514G probably damaging Het
Slc44a5 T C 3: 153,963,387 (GRCm39) F388S probably benign Het
Spmip6 A T 4: 41,505,135 (GRCm39) V196D possibly damaging Het
Tmem176b T C 6: 48,815,266 (GRCm39) N9S possibly damaging Het
Trip11 T A 12: 101,851,790 (GRCm39) Q758L probably benign Het
Trrap T A 5: 144,720,856 (GRCm39) I231N possibly damaging Het
Ttn A T 2: 76,730,397 (GRCm39) probably benign Het
Vmn2r68 T C 7: 84,870,973 (GRCm39) N770S probably damaging Het
Vmn2r73 A T 7: 85,519,544 (GRCm39) Y471* probably null Het
Vmn2r8 T G 5: 108,949,589 (GRCm39) E419D probably benign Het
Wdfy4 C A 14: 32,689,604 (GRCm39) L2818F probably damaging Het
Zfhx4 A T 3: 5,308,205 (GRCm39) Y477F probably damaging Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23,730,545 (GRCm39) missense probably benign 0.22
IGL01620:Dtna APN 18 23,758,144 (GRCm39) missense probably damaging 1.00
IGL01705:Dtna APN 18 23,678,788 (GRCm39) missense probably damaging 1.00
IGL01914:Dtna APN 18 23,730,516 (GRCm39) missense possibly damaging 0.62
IGL02388:Dtna APN 18 23,730,571 (GRCm39) missense probably benign 0.00
IGL02427:Dtna APN 18 23,784,595 (GRCm39) missense possibly damaging 0.95
IGL03074:Dtna APN 18 23,735,662 (GRCm39) missense possibly damaging 0.74
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0078:Dtna UTSW 18 23,754,499 (GRCm39) missense probably damaging 1.00
R0390:Dtna UTSW 18 23,730,558 (GRCm39) missense probably damaging 1.00
R1808:Dtna UTSW 18 23,702,697 (GRCm39) missense probably damaging 1.00
R1872:Dtna UTSW 18 23,730,617 (GRCm39) critical splice donor site probably null
R2095:Dtna UTSW 18 23,702,805 (GRCm39) missense probably damaging 1.00
R2216:Dtna UTSW 18 23,702,622 (GRCm39) missense probably damaging 1.00
R2295:Dtna UTSW 18 23,764,469 (GRCm39) missense probably damaging 1.00
R2402:Dtna UTSW 18 23,728,535 (GRCm39) nonsense probably null
R2846:Dtna UTSW 18 23,784,560 (GRCm39) splice site probably null
R3836:Dtna UTSW 18 23,758,159 (GRCm39) missense probably damaging 1.00
R4764:Dtna UTSW 18 23,668,206 (GRCm39) splice site probably null
R4893:Dtna UTSW 18 23,702,724 (GRCm39) missense probably damaging 0.99
R5194:Dtna UTSW 18 23,723,302 (GRCm39) nonsense probably null
R5373:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5374:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5526:Dtna UTSW 18 23,779,287 (GRCm39) missense probably damaging 0.99
R5755:Dtna UTSW 18 23,754,520 (GRCm39) missense probably benign
R5769:Dtna UTSW 18 23,784,611 (GRCm39) missense probably benign 0.27
R6062:Dtna UTSW 18 23,755,113 (GRCm39) missense possibly damaging 0.87
R6876:Dtna UTSW 18 23,744,167 (GRCm39) missense probably benign 0.00
R7103:Dtna UTSW 18 23,786,436 (GRCm39) critical splice donor site probably null
R7711:Dtna UTSW 18 23,758,253 (GRCm39) critical splice donor site probably null
R7804:Dtna UTSW 18 23,728,666 (GRCm39) missense probably damaging 0.97
R8156:Dtna UTSW 18 23,723,388 (GRCm39) nonsense probably null
R8437:Dtna UTSW 18 23,723,398 (GRCm39) nonsense probably null
R8786:Dtna UTSW 18 23,716,190 (GRCm39) missense probably benign 0.10
R9038:Dtna UTSW 18 23,743,553 (GRCm39) missense probably benign
R9268:Dtna UTSW 18 23,702,643 (GRCm39) missense possibly damaging 0.93
R9416:Dtna UTSW 18 23,780,112 (GRCm39) critical splice donor site probably null
R9578:Dtna UTSW 18 23,728,612 (GRCm39) missense probably damaging 0.98
R9605:Dtna UTSW 18 23,764,454 (GRCm39) missense probably damaging 1.00
R9638:Dtna UTSW 18 23,744,122 (GRCm39) missense probably benign
X0063:Dtna UTSW 18 23,776,225 (GRCm39) missense probably damaging 0.98
X0066:Dtna UTSW 18 23,726,038 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGGTTTGCTCTTAGAAGGAATAGC -3'
(R):5'- GTCATTCAGAAGCTTGGCTGG -3'

Sequencing Primer
(F):5'- CATGGGAGTTCACATTCC -3'
(R):5'- CTGGCTGCTGTCAGTCCTG -3'
Posted On 2018-05-04