Incidental Mutation 'R6413:Dtna'
ID514834
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Namedystrobrevin alpha
Synonymsalpha-dystrobrevin, adbn, Dtn, a-DB-1, A0, 87K protein, 2210407P21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location23415135-23659715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23622014 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 464 (D464E)
Ref Sequence ENSEMBL: ENSMUSP00000152288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115832] [ENSMUST00000220904] [ENSMUST00000221880]
Predicted Effect probably damaging
Transcript: ENSMUST00000115832
AA Change: D407E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302
AA Change: D407E

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220904
AA Change: D464E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221880
AA Change: D464E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.0677 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23597488 missense probably benign 0.22
IGL01620:Dtna APN 18 23625087 missense probably damaging 1.00
IGL01705:Dtna APN 18 23545731 missense probably damaging 1.00
IGL01914:Dtna APN 18 23597459 missense possibly damaging 0.62
IGL02388:Dtna APN 18 23597514 missense probably benign 0.00
IGL02427:Dtna APN 18 23651538 missense possibly damaging 0.95
IGL03074:Dtna APN 18 23602605 missense possibly damaging 0.74
R0041:Dtna UTSW 18 23646875 unclassified probably benign
R0041:Dtna UTSW 18 23646875 unclassified probably benign
R0078:Dtna UTSW 18 23621442 missense probably damaging 1.00
R0390:Dtna UTSW 18 23597501 missense probably damaging 1.00
R1808:Dtna UTSW 18 23569640 missense probably damaging 1.00
R1872:Dtna UTSW 18 23597560 critical splice donor site probably null
R2095:Dtna UTSW 18 23569748 missense probably damaging 1.00
R2216:Dtna UTSW 18 23569565 missense probably damaging 1.00
R2295:Dtna UTSW 18 23631412 missense probably damaging 1.00
R2402:Dtna UTSW 18 23595478 nonsense probably null
R2846:Dtna UTSW 18 23651503 splice site probably null
R3836:Dtna UTSW 18 23625102 missense probably damaging 1.00
R4764:Dtna UTSW 18 23535149 splice site probably null
R4893:Dtna UTSW 18 23569667 missense probably damaging 0.99
R5194:Dtna UTSW 18 23590245 nonsense probably null
R5373:Dtna UTSW 18 23651613 missense probably damaging 1.00
R5374:Dtna UTSW 18 23651613 missense probably damaging 1.00
R5526:Dtna UTSW 18 23646230 missense probably damaging 0.99
R5755:Dtna UTSW 18 23621463 missense probably benign
R5769:Dtna UTSW 18 23651554 missense probably benign 0.27
R6062:Dtna UTSW 18 23622056 missense possibly damaging 0.87
R6876:Dtna UTSW 18 23611110 missense probably benign 0.00
R7103:Dtna UTSW 18 23653379 critical splice donor site probably null
R7711:Dtna UTSW 18 23625196 critical splice donor site probably null
R7804:Dtna UTSW 18 23595609 missense probably damaging 0.97
R8156:Dtna UTSW 18 23590331 nonsense probably null
R8437:Dtna UTSW 18 23590341 nonsense probably null
X0063:Dtna UTSW 18 23643168 missense probably damaging 0.98
X0066:Dtna UTSW 18 23592981 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGGTTTGCTCTTAGAAGGAATAGC -3'
(R):5'- GTCATTCAGAAGCTTGGCTGG -3'

Sequencing Primer
(F):5'- CATGGGAGTTCACATTCC -3'
(R):5'- CTGGCTGCTGTCAGTCCTG -3'
Posted On2018-05-04