Incidental Mutation 'R6413:Cabp2'
ID514835
Institutional Source Beutler Lab
Gene Symbol Cabp2
Ensembl Gene ENSMUSG00000024857
Gene Namecalcium binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4081578-4087340 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 4085698 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159148] [ENSMUST00000159556] [ENSMUST00000159593] [ENSMUST00000162908]
Predicted Effect probably null
Transcript: ENSMUST00000159148
SMART Domains Protein: ENSMUSP00000125740
Gene: ENSMUSG00000024857

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
EFh 65 93 2.62e-5 SMART
Blast:EFh 101 126 3e-6 BLAST
EFh 139 167 1.26e-7 SMART
EFh 176 203 3.85e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159556
SMART Domains Protein: ENSMUSP00000124389
Gene: ENSMUSG00000024857

DomainStartEndE-ValueType
EFh 30 58 2.62e-5 SMART
Blast:EFh 66 91 2e-6 BLAST
EFh 104 132 1.26e-7 SMART
EFh 141 168 3.85e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159593
SMART Domains Protein: ENSMUSP00000124607
Gene: ENSMUSG00000024857

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
Pfam:EF-hand_1 65 93 2.8e-9 PFAM
Pfam:EF-hand_6 65 96 6.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162584
Predicted Effect probably null
Transcript: ENSMUST00000162908
SMART Domains Protein: ENSMUSP00000125255
Gene: ENSMUSG00000024857

DomainStartEndE-ValueType
low complexity region 25 39 N/A INTRINSIC
EFh 83 111 2.62e-5 SMART
Blast:EFh 119 144 4e-6 BLAST
EFh 157 185 1.26e-7 SMART
EFh 194 221 3.85e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a subfamily of calcium binding proteins that share similarity to calmodulin. Like calmodulin, these family members can likely stimulate calmodulin-dependent kinase II and the protein phosphatase calcineurin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous knockout affects calcium channels in cochlear inner hair cell synapses, resulting in hearing impairment. It also affects transmission of responses to light through the retinal circuits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Cabp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Cabp2 APN 19 4084868 splice site probably benign
IGL02338:Cabp2 APN 19 4084154 missense possibly damaging 0.74
R0017:Cabp2 UTSW 19 4086242 missense possibly damaging 0.88
R0153:Cabp2 UTSW 19 4084913 splice site probably benign
R0432:Cabp2 UTSW 19 4084903 missense possibly damaging 0.59
R2027:Cabp2 UTSW 19 4087126 missense probably damaging 1.00
R3693:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R3694:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R3695:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R5935:Cabp2 UTSW 19 4086497 missense probably damaging 1.00
R5939:Cabp2 UTSW 19 4086470 missense possibly damaging 0.85
R7023:Cabp2 UTSW 19 4082658 critical splice acceptor site probably null
R8113:Cabp2 UTSW 19 4085582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGCAAAGGCTCTTGGG -3'
(R):5'- AAGTCACAGTTTCTTGGTTTCTCTG -3'

Sequencing Primer
(F):5'- CTCTTGGGTAACAACTAGGAACTG -3'
(R):5'- GCCCCTGCTGTGTGACTCTAG -3'
Posted On2018-05-04