Incidental Mutation 'R6414:Rasef'
ID514848
Institutional Source Beutler Lab
Gene Symbol Rasef
Ensembl Gene ENSMUSG00000043003
Gene NameRAS and EF hand domain containing
SynonymsRAB45
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6414 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location73714579-73790994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73740581 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 463 (V463M)
Ref Sequence ENSEMBL: ENSMUSP00000152127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]
Predicted Effect probably benign
Transcript: ENSMUST00000058292
AA Change: V382M

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: V382M

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
coiled coil region 55 251 N/A INTRINSIC
RAB 429 598 4.94e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102837
AA Change: V310M

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: V310M

DomainStartEndE-ValueType
coiled coil region 5 179 N/A INTRINSIC
RAB 357 526 4.94e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222414
AA Change: V463M

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A G 11: 69,884,336 V367A probably benign Het
Alpk1 T C 3: 127,680,209 D715G probably benign Het
Atg101 T A 15: 101,290,460 C149S probably benign Het
Atp2c1 A T 9: 105,466,656 I84N probably damaging Het
Ceacam20 C A 7: 19,976,131 A360E probably damaging Het
Chd3 A T 11: 69,352,545 probably null Het
Clcc1 G A 3: 108,676,851 C517Y possibly damaging Het
Col6a5 T C 9: 105,892,266 probably null Het
Ctnna3 T C 10: 64,260,865 V394A probably benign Het
Ctsll3 A G 13: 60,800,299 F188S probably damaging Het
Cyth4 T C 15: 78,608,146 V125A probably damaging Het
Ddx43 G A 9: 78,400,936 V131I probably benign Het
Elp4 A G 2: 105,904,443 S16P possibly damaging Het
Espl1 T A 15: 102,315,560 V1182E probably damaging Het
Fhod3 T C 18: 25,090,878 S1094P possibly damaging Het
Fmo6 A T 1: 162,920,445 V350D probably damaging Het
Frem1 A G 4: 82,940,536 F1545S probably damaging Het
Gata3 T A 2: 9,858,434 H423L possibly damaging Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Golt1a A T 1: 133,320,294 M87L probably damaging Het
Gpr171 A T 3: 59,098,123 V77E probably damaging Het
Hectd2 A G 19: 36,618,786 D757G probably benign Het
Hmmr A G 11: 40,715,867 probably null Het
Il31ra A G 13: 112,523,907 V635A possibly damaging Het
Lama1 T C 17: 67,746,910 probably null Het
Ltbp4 G A 7: 27,310,715 P1140L probably damaging Het
Macf1 A G 4: 123,493,195 L1210P possibly damaging Het
Meox2 A T 12: 37,108,831 M1L probably benign Het
Mex3d A G 10: 80,381,371 S671P unknown Het
Mrgprb2 C T 7: 48,552,381 V199I probably benign Het
Mroh9 A T 1: 163,074,702 V114E probably damaging Het
Muc5b A G 7: 141,859,097 K1927E unknown Het
Olfr1275 A C 2: 111,231,152 probably null Het
Olfr781 T A 10: 129,333,709 I276K probably benign Het
Otogl C T 10: 107,782,050 C1734Y probably damaging Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh15 T A 10: 74,185,426 N162K probably damaging Het
Pcdhb10 A C 18: 37,413,845 H658P possibly damaging Het
Pgm2l1 G T 7: 100,255,540 A160S possibly damaging Het
Prkag2 T A 5: 25,100,180 probably benign Het
Rap1gap2 A G 11: 74,405,790 L457P probably damaging Het
Rb1 T C 14: 73,282,974 S42G unknown Het
Reep3 C A 10: 67,039,577 V36F probably damaging Het
Rhcg A G 7: 79,598,968 probably null Het
Sbno1 T C 5: 124,395,931 S661G probably benign Het
Slc25a3 T G 10: 91,122,328 Q50P possibly damaging Het
Slc2a13 T A 15: 91,343,805 I395F probably benign Het
Slc6a5 C T 7: 49,910,243 probably benign Het
Snta1 G C 2: 154,378,067 T391S possibly damaging Het
Spata7 T C 12: 98,663,220 probably null Het
Stx17 A G 4: 48,158,809 probably null Het
Terf2 A T 8: 107,076,854 S365T probably benign Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trim8 A T 19: 46,502,907 H155L probably benign Het
Wipi2 T A 5: 142,655,938 V83D probably damaging Het
Zfp316 C A 5: 143,254,884 R460L possibly damaging Het
Zfp651 T G 9: 121,763,659 D348E probably benign Het
Zfp799 C T 17: 32,820,285 V336M probably damaging Het
Zfp947 A T 17: 22,146,414 I93N probably damaging Het
Zranb3 A G 1: 128,040,957 Y74H probably benign Het
Other mutations in Rasef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Rasef APN 4 73771425 nonsense probably null
IGL01329:Rasef APN 4 73727645 missense probably damaging 1.00
IGL01517:Rasef APN 4 73769822 missense probably benign 0.03
IGL02465:Rasef APN 4 73734488 missense probably damaging 1.00
IGL02676:Rasef APN 4 73759729 missense possibly damaging 0.69
IGL03137:Rasef APN 4 73734483 nonsense probably null
IGL03403:Rasef APN 4 73734534 missense probably damaging 1.00
BB001:Rasef UTSW 4 73740929 critical splice donor site probably null
BB011:Rasef UTSW 4 73740929 critical splice donor site probably null
P0033:Rasef UTSW 4 73749852 missense probably benign 0.26
R0035:Rasef UTSW 4 73762854 splice site probably benign
R0035:Rasef UTSW 4 73762854 splice site probably benign
R0317:Rasef UTSW 4 73748562 missense probably damaging 1.00
R0686:Rasef UTSW 4 73734534 missense probably damaging 1.00
R0987:Rasef UTSW 4 73734484 nonsense probably null
R1115:Rasef UTSW 4 73748604 missense possibly damaging 0.85
R1511:Rasef UTSW 4 73735748 missense probably damaging 1.00
R1585:Rasef UTSW 4 73740337 missense probably damaging 1.00
R1646:Rasef UTSW 4 73734549 missense probably damaging 1.00
R1705:Rasef UTSW 4 73744064 nonsense probably null
R1918:Rasef UTSW 4 73744114 missense possibly damaging 0.94
R1919:Rasef UTSW 4 73744114 missense possibly damaging 0.94
R3819:Rasef UTSW 4 73759705 missense probably damaging 1.00
R3891:Rasef UTSW 4 73780397 missense probably benign 0.03
R3892:Rasef UTSW 4 73780397 missense probably benign 0.03
R4344:Rasef UTSW 4 73745089 missense probably damaging 1.00
R4491:Rasef UTSW 4 73734503 missense probably damaging 1.00
R4492:Rasef UTSW 4 73734503 missense probably damaging 1.00
R4594:Rasef UTSW 4 73780389 missense possibly damaging 0.47
R4915:Rasef UTSW 4 73731459 missense probably damaging 1.00
R5276:Rasef UTSW 4 73735767 missense probably null 1.00
R5359:Rasef UTSW 4 73771328 missense probably damaging 1.00
R5682:Rasef UTSW 4 73740971 nonsense probably null
R5693:Rasef UTSW 4 73769839 missense probably damaging 0.99
R6543:Rasef UTSW 4 73780519 intron probably benign
R6593:Rasef UTSW 4 73745090 missense probably damaging 1.00
R7078:Rasef UTSW 4 73780389 missense probably benign 0.01
R7083:Rasef UTSW 4 73790984 missense probably benign 0.26
R7106:Rasef UTSW 4 73727627 missense probably damaging 1.00
R7127:Rasef UTSW 4 73744132 missense probably damaging 1.00
R7329:Rasef UTSW 4 73744137 missense probably damaging 1.00
R7767:Rasef UTSW 4 73734534 missense probably damaging 1.00
R7891:Rasef UTSW 4 73759698 missense probably benign 0.00
R7891:Rasef UTSW 4 73790964 missense probably benign
R7924:Rasef UTSW 4 73740929 critical splice donor site probably null
R7997:Rasef UTSW 4 73740562 missense possibly damaging 0.78
R8554:Rasef UTSW 4 73727607 missense probably benign 0.03
R8850:Rasef UTSW 4 73727603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCTGAGATGTGACCTTG -3'
(R):5'- GAGGGAGTCTGCTTAGTAACC -3'

Sequencing Primer
(F):5'- ATCCACCATGTCTGTCTAGAAGG -3'
(R):5'- GGAGTCTGCTTAGTAACCACACTG -3'
Posted On2018-05-04