Incidental Mutation 'R6414:Gm438'
ID514851
Institutional Source Beutler Lab
Gene Symbol Gm438
Ensembl Gene ENSMUSG00000078504
Gene Namepredicted gene 438
SynonymsLOC329993
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6414 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location144777204-144786583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144777415 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 389 (I389L)
Ref Sequence ENSEMBL: ENSMUSP00000101372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105746]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105746
AA Change: I389L

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101372
Gene: ENSMUSG00000078504
AA Change: I389L

DomainStartEndE-ValueType
transmembrane domain 3 25 N/A INTRINSIC
Pfam:Abhydrolase_3 111 270 4.9e-22 PFAM
Pfam:Abhydrolase_3 284 366 1.3e-11 PFAM
Meta Mutation Damage Score 0.1697 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A G 11: 69,884,336 V367A probably benign Het
Alpk1 T C 3: 127,680,209 D715G probably benign Het
Atg101 T A 15: 101,290,460 C149S probably benign Het
Atp2c1 A T 9: 105,466,656 I84N probably damaging Het
Ceacam20 C A 7: 19,976,131 A360E probably damaging Het
Chd3 A T 11: 69,352,545 probably null Het
Clcc1 G A 3: 108,676,851 C517Y possibly damaging Het
Col6a5 T C 9: 105,892,266 probably null Het
Ctnna3 T C 10: 64,260,865 V394A probably benign Het
Ctsll3 A G 13: 60,800,299 F188S probably damaging Het
Cyth4 T C 15: 78,608,146 V125A probably damaging Het
Ddx43 G A 9: 78,400,936 V131I probably benign Het
Elp4 A G 2: 105,904,443 S16P possibly damaging Het
Espl1 T A 15: 102,315,560 V1182E probably damaging Het
Fhod3 T C 18: 25,090,878 S1094P possibly damaging Het
Fmo6 A T 1: 162,920,445 V350D probably damaging Het
Frem1 A G 4: 82,940,536 F1545S probably damaging Het
Gata3 T A 2: 9,858,434 H423L possibly damaging Het
Golt1a A T 1: 133,320,294 M87L probably damaging Het
Gpr171 A T 3: 59,098,123 V77E probably damaging Het
Hectd2 A G 19: 36,618,786 D757G probably benign Het
Hmmr A G 11: 40,715,867 probably null Het
Il31ra A G 13: 112,523,907 V635A possibly damaging Het
Lama1 T C 17: 67,746,910 probably null Het
Ltbp4 G A 7: 27,310,715 P1140L probably damaging Het
Macf1 A G 4: 123,493,195 L1210P possibly damaging Het
Meox2 A T 12: 37,108,831 M1L probably benign Het
Mex3d A G 10: 80,381,371 S671P unknown Het
Mrgprb2 C T 7: 48,552,381 V199I probably benign Het
Mroh9 A T 1: 163,074,702 V114E probably damaging Het
Muc5b A G 7: 141,859,097 K1927E unknown Het
Olfr1275 A C 2: 111,231,152 probably null Het
Olfr781 T A 10: 129,333,709 I276K probably benign Het
Otogl C T 10: 107,782,050 C1734Y probably damaging Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh15 T A 10: 74,185,426 N162K probably damaging Het
Pcdhb10 A C 18: 37,413,845 H658P possibly damaging Het
Pgm2l1 G T 7: 100,255,540 A160S possibly damaging Het
Prkag2 T A 5: 25,100,180 probably benign Het
Rap1gap2 A G 11: 74,405,790 L457P probably damaging Het
Rasef C T 4: 73,740,581 V463M probably benign Het
Rb1 T C 14: 73,282,974 S42G unknown Het
Reep3 C A 10: 67,039,577 V36F probably damaging Het
Rhcg A G 7: 79,598,968 probably null Het
Sbno1 T C 5: 124,395,931 S661G probably benign Het
Slc25a3 T G 10: 91,122,328 Q50P possibly damaging Het
Slc2a13 T A 15: 91,343,805 I395F probably benign Het
Slc6a5 C T 7: 49,910,243 probably benign Het
Snta1 G C 2: 154,378,067 T391S possibly damaging Het
Spata7 T C 12: 98,663,220 probably null Het
Stx17 A G 4: 48,158,809 probably null Het
Terf2 A T 8: 107,076,854 S365T probably benign Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trim8 A T 19: 46,502,907 H155L probably benign Het
Wipi2 T A 5: 142,655,938 V83D probably damaging Het
Zfp316 C A 5: 143,254,884 R460L possibly damaging Het
Zfp651 T G 9: 121,763,659 D348E probably benign Het
Zfp799 C T 17: 32,820,285 V336M probably damaging Het
Zfp947 A T 17: 22,146,414 I93N probably damaging Het
Zranb3 A G 1: 128,040,957 Y74H probably benign Het
Other mutations in Gm438
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Gm438 APN 4 144777689 nonsense probably null
IGL01293:Gm438 APN 4 144777589 missense probably benign 0.00
IGL01678:Gm438 APN 4 144777873 missense probably benign 0.20
IGL02609:Gm438 APN 4 144779737 missense probably damaging 1.00
IGL02684:Gm438 APN 4 144778185 splice site probably benign
IGL02734:Gm438 APN 4 144779779 missense probably damaging 1.00
IGL02869:Gm438 APN 4 144786368 missense probably benign 0.01
IGL02988:Gm438 APN 4 144786530 utr 5 prime probably benign
R0553:Gm438 UTSW 4 144777415 missense possibly damaging 0.57
R1514:Gm438 UTSW 4 144777759 missense probably damaging 1.00
R1856:Gm438 UTSW 4 144777883 missense probably benign
R1957:Gm438 UTSW 4 144777819 missense possibly damaging 0.94
R2014:Gm438 UTSW 4 144779725 missense probably damaging 1.00
R2243:Gm438 UTSW 4 144777421 missense probably benign
R4943:Gm438 UTSW 4 144777720 missense probably benign 0.07
R5439:Gm438 UTSW 4 144778113 missense probably damaging 1.00
R5520:Gm438 UTSW 4 144778024 missense probably benign 0.00
R6664:Gm438 UTSW 4 144777399 makesense probably null
R6869:Gm438 UTSW 4 144780472 critical splice donor site probably null
R7384:Gm438 UTSW 4 144780621 missense possibly damaging 0.89
R7439:Gm438 UTSW 4 144777762 missense probably damaging 1.00
R7484:Gm438 UTSW 4 144777951 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CACACTGTATTTGTGGTATAAGAGAG -3'
(R):5'- GACATTCCTGGTGAGCTGTG -3'

Sequencing Primer
(F):5'- GAACACAAATTTGACTTATTGAGCAG -3'
(R):5'- CATTCCTGGTGAGCTGTGAACATG -3'
Posted On2018-05-04