Incidental Mutation 'R6414:Hmmr'
ID514875
Institutional Source Beutler Lab
Gene Symbol Hmmr
Ensembl Gene ENSMUSG00000020330
Gene Namehyaluronan mediated motility receptor (RHAMM)
SynonymsCD168, Rhamm
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6414 (G1)
Quality Score175.009
Status Validated
Chromosome11
Chromosomal Location40701395-40733422 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 40715867 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020579]
Predicted Effect probably null
Transcript: ENSMUST00000020579
SMART Domains Protein: ENSMUSP00000020579
Gene: ENSMUSG00000020330

DomainStartEndE-ValueType
Pfam:HMMR_N 15 339 1.2e-136 PFAM
low complexity region 375 385 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
Blast:MA 452 578 7e-6 BLAST
Pfam:HMMR_C 636 789 4.3e-71 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cell motility. It is expressed in breast tissue and together with other proteins, it forms a complex with BRCA1 and BRCA2, thus is potentially associated with higher risk of breast cancer. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit impaired fertility and are less susceptible to the formation of aggressive fibromatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A G 11: 69,884,336 V367A probably benign Het
Alpk1 T C 3: 127,680,209 D715G probably benign Het
Atg101 T A 15: 101,290,460 C149S probably benign Het
Atp2c1 A T 9: 105,466,656 I84N probably damaging Het
Ceacam20 C A 7: 19,976,131 A360E probably damaging Het
Chd3 A T 11: 69,352,545 probably null Het
Clcc1 G A 3: 108,676,851 C517Y possibly damaging Het
Col6a5 T C 9: 105,892,266 probably null Het
Ctnna3 T C 10: 64,260,865 V394A probably benign Het
Ctsll3 A G 13: 60,800,299 F188S probably damaging Het
Cyth4 T C 15: 78,608,146 V125A probably damaging Het
Ddx43 G A 9: 78,400,936 V131I probably benign Het
Elp4 A G 2: 105,904,443 S16P possibly damaging Het
Espl1 T A 15: 102,315,560 V1182E probably damaging Het
Fhod3 T C 18: 25,090,878 S1094P possibly damaging Het
Fmo6 A T 1: 162,920,445 V350D probably damaging Het
Frem1 A G 4: 82,940,536 F1545S probably damaging Het
Gata3 T A 2: 9,858,434 H423L possibly damaging Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Golt1a A T 1: 133,320,294 M87L probably damaging Het
Gpr171 A T 3: 59,098,123 V77E probably damaging Het
Hectd2 A G 19: 36,618,786 D757G probably benign Het
Il31ra A G 13: 112,523,907 V635A possibly damaging Het
Lama1 T C 17: 67,746,910 probably null Het
Ltbp4 G A 7: 27,310,715 P1140L probably damaging Het
Macf1 A G 4: 123,493,195 L1210P possibly damaging Het
Meox2 A T 12: 37,108,831 M1L probably benign Het
Mex3d A G 10: 80,381,371 S671P unknown Het
Mrgprb2 C T 7: 48,552,381 V199I probably benign Het
Mroh9 A T 1: 163,074,702 V114E probably damaging Het
Muc5b A G 7: 141,859,097 K1927E unknown Het
Olfr1275 A C 2: 111,231,152 probably null Het
Olfr781 T A 10: 129,333,709 I276K probably benign Het
Otogl C T 10: 107,782,050 C1734Y probably damaging Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh15 T A 10: 74,185,426 N162K probably damaging Het
Pcdhb10 A C 18: 37,413,845 H658P possibly damaging Het
Pgm2l1 G T 7: 100,255,540 A160S possibly damaging Het
Prkag2 T A 5: 25,100,180 probably benign Het
Rap1gap2 A G 11: 74,405,790 L457P probably damaging Het
Rasef C T 4: 73,740,581 V463M probably benign Het
Rb1 T C 14: 73,282,974 S42G unknown Het
Reep3 C A 10: 67,039,577 V36F probably damaging Het
Rhcg A G 7: 79,598,968 probably null Het
Sbno1 T C 5: 124,395,931 S661G probably benign Het
Slc25a3 T G 10: 91,122,328 Q50P possibly damaging Het
Slc2a13 T A 15: 91,343,805 I395F probably benign Het
Slc6a5 C T 7: 49,910,243 probably benign Het
Snta1 G C 2: 154,378,067 T391S possibly damaging Het
Spata7 T C 12: 98,663,220 probably null Het
Stx17 A G 4: 48,158,809 probably null Het
Terf2 A T 8: 107,076,854 S365T probably benign Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trim8 A T 19: 46,502,907 H155L probably benign Het
Wipi2 T A 5: 142,655,938 V83D probably damaging Het
Zfp316 C A 5: 143,254,884 R460L possibly damaging Het
Zfp651 T G 9: 121,763,659 D348E probably benign Het
Zfp799 C T 17: 32,820,285 V336M probably damaging Het
Zfp947 A T 17: 22,146,414 I93N probably damaging Het
Zranb3 A G 1: 128,040,957 Y74H probably benign Het
Other mutations in Hmmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01795:Hmmr APN 11 40721734 missense probably benign 0.25
IGL02096:Hmmr APN 11 40707429 missense probably benign 0.02
IGL02224:Hmmr APN 11 40710004 missense unknown
IGL02527:Hmmr APN 11 40708105 missense probably damaging 1.00
IGL02870:Hmmr APN 11 40714075 missense possibly damaging 0.63
IGL03175:Hmmr APN 11 40714809 missense probably benign 0.02
IGL03327:Hmmr APN 11 40715415 missense probably damaging 1.00
R0126:Hmmr UTSW 11 40705954 missense probably damaging 1.00
R0211:Hmmr UTSW 11 40714808 missense probably damaging 0.96
R0533:Hmmr UTSW 11 40709989 missense unknown
R0610:Hmmr UTSW 11 40715902 missense probably damaging 1.00
R0747:Hmmr UTSW 11 40721745 splice site probably benign
R1909:Hmmr UTSW 11 40708098 missense probably damaging 1.00
R2013:Hmmr UTSW 11 40728432 missense possibly damaging 0.85
R4446:Hmmr UTSW 11 40715321 missense probably damaging 1.00
R4897:Hmmr UTSW 11 40728434 missense probably benign 0.00
R4937:Hmmr UTSW 11 40721840 missense possibly damaging 0.90
R5795:Hmmr UTSW 11 40721906 missense probably damaging 1.00
R5873:Hmmr UTSW 11 40707700 missense probably damaging 0.99
R6962:Hmmr UTSW 11 40707415 missense probably damaging 1.00
R7391:Hmmr UTSW 11 40707786 intron probably null
R7558:Hmmr UTSW 11 40733329 missense probably damaging 1.00
R8065:Hmmr UTSW 11 40721672
R8066:Hmmr UTSW 11 40721672
T0975:Hmmr UTSW 11 40723416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTGATCAGATGCACAGCTG -3'
(R):5'- TTGACCTCTAGTGTTACCTTACATG -3'

Sequencing Primer
(F):5'- TGCACCACATGTATGCAGTG -3'
(R):5'- CTTTTTCAGTGTTTCAATAGAGA -3'
Posted On2018-05-04