Incidental Mutation 'R6414:Spata7'
ID514880
Institutional Source Beutler Lab
Gene Symbol Spata7
Ensembl Gene ENSMUSG00000021007
Gene Namespermatogenesis associated 7
SynonymsB230306G18Rik, HSD3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6414 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location98628157-98669815 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 98663220 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048402] [ENSMUST00000101144] [ENSMUST00000101146]
Predicted Effect probably null
Transcript: ENSMUST00000048402
SMART Domains Protein: ENSMUSP00000045827
Gene: ENSMUSG00000021007

DomainStartEndE-ValueType
Pfam:HSD3 9 410 1e-190 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101144
SMART Domains Protein: ENSMUSP00000098704
Gene: ENSMUSG00000021007

DomainStartEndE-ValueType
Pfam:HSD3 6 131 7.5e-73 PFAM
Pfam:HSD3 122 244 6e-63 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101146
SMART Domains Protein: ENSMUSP00000098705
Gene: ENSMUSG00000021007

DomainStartEndE-ValueType
Pfam:HSD3 6 33 1e-11 PFAM
Pfam:HSD3 31 379 2.1e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152482
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, originally isolated from testis, is also expressed in retina. Mutations in this gene are associated with Leber congenital amaurosis and juvenile retinitis pigmentosa. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele display progressive retinal rod cell degeneration, a thin retinal outer nuclear layer and impaired scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A G 11: 69,884,336 V367A probably benign Het
Alpk1 T C 3: 127,680,209 D715G probably benign Het
Atg101 T A 15: 101,290,460 C149S probably benign Het
Atp2c1 A T 9: 105,466,656 I84N probably damaging Het
Ceacam20 C A 7: 19,976,131 A360E probably damaging Het
Chd3 A T 11: 69,352,545 probably null Het
Clcc1 G A 3: 108,676,851 C517Y possibly damaging Het
Col6a5 T C 9: 105,892,266 probably null Het
Ctnna3 T C 10: 64,260,865 V394A probably benign Het
Ctsll3 A G 13: 60,800,299 F188S probably damaging Het
Cyth4 T C 15: 78,608,146 V125A probably damaging Het
Ddx43 G A 9: 78,400,936 V131I probably benign Het
Elp4 A G 2: 105,904,443 S16P possibly damaging Het
Espl1 T A 15: 102,315,560 V1182E probably damaging Het
Fhod3 T C 18: 25,090,878 S1094P possibly damaging Het
Fmo6 A T 1: 162,920,445 V350D probably damaging Het
Frem1 A G 4: 82,940,536 F1545S probably damaging Het
Gata3 T A 2: 9,858,434 H423L possibly damaging Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Golt1a A T 1: 133,320,294 M87L probably damaging Het
Gpr171 A T 3: 59,098,123 V77E probably damaging Het
Hectd2 A G 19: 36,618,786 D757G probably benign Het
Hmmr A G 11: 40,715,867 probably null Het
Il31ra A G 13: 112,523,907 V635A possibly damaging Het
Lama1 T C 17: 67,746,910 probably null Het
Ltbp4 G A 7: 27,310,715 P1140L probably damaging Het
Macf1 A G 4: 123,493,195 L1210P possibly damaging Het
Meox2 A T 12: 37,108,831 M1L probably benign Het
Mex3d A G 10: 80,381,371 S671P unknown Het
Mrgprb2 C T 7: 48,552,381 V199I probably benign Het
Mroh9 A T 1: 163,074,702 V114E probably damaging Het
Muc5b A G 7: 141,859,097 K1927E unknown Het
Olfr1275 A C 2: 111,231,152 probably null Het
Olfr781 T A 10: 129,333,709 I276K probably benign Het
Otogl C T 10: 107,782,050 C1734Y probably damaging Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh15 T A 10: 74,185,426 N162K probably damaging Het
Pcdhb10 A C 18: 37,413,845 H658P possibly damaging Het
Pgm2l1 G T 7: 100,255,540 A160S possibly damaging Het
Prkag2 T A 5: 25,100,180 probably benign Het
Rap1gap2 A G 11: 74,405,790 L457P probably damaging Het
Rasef C T 4: 73,740,581 V463M probably benign Het
Rb1 T C 14: 73,282,974 S42G unknown Het
Reep3 C A 10: 67,039,577 V36F probably damaging Het
Rhcg A G 7: 79,598,968 probably null Het
Sbno1 T C 5: 124,395,931 S661G probably benign Het
Slc25a3 T G 10: 91,122,328 Q50P possibly damaging Het
Slc2a13 T A 15: 91,343,805 I395F probably benign Het
Slc6a5 C T 7: 49,910,243 probably benign Het
Snta1 G C 2: 154,378,067 T391S possibly damaging Het
Stx17 A G 4: 48,158,809 probably null Het
Terf2 A T 8: 107,076,854 S365T probably benign Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trim8 A T 19: 46,502,907 H155L probably benign Het
Wipi2 T A 5: 142,655,938 V83D probably damaging Het
Zfp316 C A 5: 143,254,884 R460L possibly damaging Het
Zfp651 T G 9: 121,763,659 D348E probably benign Het
Zfp799 C T 17: 32,820,285 V336M probably damaging Het
Zfp947 A T 17: 22,146,414 I93N probably damaging Het
Zranb3 A G 1: 128,040,957 Y74H probably benign Het
Other mutations in Spata7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Spata7 APN 12 98668840 missense probably damaging 1.00
IGL02283:Spata7 APN 12 98658258 missense probably damaging 0.96
IGL02379:Spata7 APN 12 98634260 missense probably damaging 1.00
R0200:Spata7 UTSW 12 98663169 missense probably benign 0.32
R0422:Spata7 UTSW 12 98658265 missense probably damaging 0.99
R0847:Spata7 UTSW 12 98648430 missense possibly damaging 0.82
R1228:Spata7 UTSW 12 98634269 missense probably damaging 1.00
R1497:Spata7 UTSW 12 98668861 missense probably damaging 1.00
R1693:Spata7 UTSW 12 98664257 missense possibly damaging 0.85
R2183:Spata7 UTSW 12 98637612 missense probably damaging 1.00
R2507:Spata7 UTSW 12 98658450 missense probably benign
R3176:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3177:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3276:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3277:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3951:Spata7 UTSW 12 98669473 missense probably damaging 0.98
R4698:Spata7 UTSW 12 98664277 missense probably damaging 1.00
R4919:Spata7 UTSW 12 98648453 missense possibly damaging 0.65
R5088:Spata7 UTSW 12 98669502 missense probably benign 0.43
R5583:Spata7 UTSW 12 98669331 missense probably damaging 0.98
R6451:Spata7 UTSW 12 98658337 missense probably benign 0.02
R7167:Spata7 UTSW 12 98664296 missense probably damaging 1.00
R7316:Spata7 UTSW 12 98658612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGCCACGAGTAAGTTG -3'
(R):5'- ACTTAGGGATGCATTTCCACTAAAG -3'

Sequencing Primer
(F):5'- GTCCTTGAAACTCATTGCACATGTG -3'
(R):5'- GATTAAATGCCCAGGATTCCCC -3'
Posted On2018-05-04