Incidental Mutation 'R6414:Zfp799'
ID514889
Institutional Source Beutler Lab
Gene Symbol Zfp799
Ensembl Gene ENSMUSG00000095253
Gene Namezinc finger protein 799
Synonyms6030490I01Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_177359.4; MGI:2443934

Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R6414 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32815449-32830261 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32820285 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 336 (V336M)
Ref Sequence ENSEMBL: ENSMUSP00000144480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179695] [ENSMUST00000201499] [ENSMUST00000201876] [ENSMUST00000202759] [ENSMUST00000202988]
Predicted Effect possibly damaging
Transcript: ENSMUST00000179695
AA Change: V335M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136298
Gene: ENSMUSG00000095253
AA Change: V335M

DomainStartEndE-ValueType
KRAB 3 60 1.22e-9 SMART
low complexity region 97 110 N/A INTRINSIC
ZnF_C2H2 194 216 1.2e-3 SMART
ZnF_C2H2 222 244 1.28e-3 SMART
ZnF_C2H2 250 272 4.87e-4 SMART
ZnF_C2H2 278 300 9.08e-4 SMART
ZnF_C2H2 306 328 2.27e-4 SMART
ZnF_C2H2 334 356 1.53e-1 SMART
ZnF_C2H2 360 382 4.34e-1 SMART
ZnF_C2H2 388 410 1.84e-4 SMART
ZnF_C2H2 416 438 9.58e-3 SMART
ZnF_C2H2 444 466 6.32e-3 SMART
ZnF_C2H2 472 494 2.95e-3 SMART
ZnF_C2H2 500 522 2.2e-2 SMART
ZnF_C2H2 528 550 1.56e-2 SMART
ZnF_C2H2 556 578 2.4e-3 SMART
ZnF_C2H2 584 606 2.53e-2 SMART
ZnF_C2H2 612 634 4.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181318
Predicted Effect probably benign
Transcript: ENSMUST00000201499
SMART Domains Protein: ENSMUSP00000143907
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 61 1.22e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201876
SMART Domains Protein: ENSMUSP00000144187
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 61 5.3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202759
SMART Domains Protein: ENSMUSP00000144087
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 63 5.6e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202988
AA Change: V336M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144480
Gene: ENSMUSG00000095253
AA Change: V336M

DomainStartEndE-ValueType
KRAB 4 61 1.22e-9 SMART
low complexity region 98 111 N/A INTRINSIC
ZnF_C2H2 195 217 1.2e-3 SMART
ZnF_C2H2 223 245 1.28e-3 SMART
ZnF_C2H2 251 273 4.87e-4 SMART
ZnF_C2H2 279 301 9.08e-4 SMART
ZnF_C2H2 307 329 2.27e-4 SMART
ZnF_C2H2 335 357 1.53e-1 SMART
ZnF_C2H2 361 383 4.34e-1 SMART
ZnF_C2H2 389 411 1.84e-4 SMART
ZnF_C2H2 417 439 9.58e-3 SMART
ZnF_C2H2 445 467 6.32e-3 SMART
ZnF_C2H2 473 495 2.95e-3 SMART
ZnF_C2H2 501 523 2.2e-2 SMART
ZnF_C2H2 529 551 1.56e-2 SMART
ZnF_C2H2 557 579 2.4e-3 SMART
ZnF_C2H2 585 607 2.53e-2 SMART
ZnF_C2H2 613 635 4.47e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A G 11: 69,884,336 V367A probably benign Het
Alpk1 T C 3: 127,680,209 D715G probably benign Het
Atg101 T A 15: 101,290,460 C149S probably benign Het
Atp2c1 A T 9: 105,466,656 I84N probably damaging Het
Ceacam20 C A 7: 19,976,131 A360E probably damaging Het
Chd3 A T 11: 69,352,545 probably null Het
Clcc1 G A 3: 108,676,851 C517Y possibly damaging Het
Col6a5 T C 9: 105,892,266 probably null Het
Ctnna3 T C 10: 64,260,865 V394A probably benign Het
Ctsll3 A G 13: 60,800,299 F188S probably damaging Het
Cyth4 T C 15: 78,608,146 V125A probably damaging Het
Ddx43 G A 9: 78,400,936 V131I probably benign Het
Elp4 A G 2: 105,904,443 S16P possibly damaging Het
Espl1 T A 15: 102,315,560 V1182E probably damaging Het
Fhod3 T C 18: 25,090,878 S1094P possibly damaging Het
Fmo6 A T 1: 162,920,445 V350D probably damaging Het
Frem1 A G 4: 82,940,536 F1545S probably damaging Het
Gata3 T A 2: 9,858,434 H423L possibly damaging Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Golt1a A T 1: 133,320,294 M87L probably damaging Het
Gpr171 A T 3: 59,098,123 V77E probably damaging Het
Hectd2 A G 19: 36,618,786 D757G probably benign Het
Hmmr A G 11: 40,715,867 probably null Het
Il31ra A G 13: 112,523,907 V635A possibly damaging Het
Lama1 T C 17: 67,746,910 probably null Het
Ltbp4 G A 7: 27,310,715 P1140L probably damaging Het
Macf1 A G 4: 123,493,195 L1210P possibly damaging Het
Meox2 A T 12: 37,108,831 M1L probably benign Het
Mex3d A G 10: 80,381,371 S671P unknown Het
Mrgprb2 C T 7: 48,552,381 V199I probably benign Het
Mroh9 A T 1: 163,074,702 V114E probably damaging Het
Muc5b A G 7: 141,859,097 K1927E unknown Het
Olfr1275 A C 2: 111,231,152 probably null Het
Olfr781 T A 10: 129,333,709 I276K probably benign Het
Otogl C T 10: 107,782,050 C1734Y probably damaging Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh15 T A 10: 74,185,426 N162K probably damaging Het
Pcdhb10 A C 18: 37,413,845 H658P possibly damaging Het
Pgm2l1 G T 7: 100,255,540 A160S possibly damaging Het
Prkag2 T A 5: 25,100,180 probably benign Het
Rap1gap2 A G 11: 74,405,790 L457P probably damaging Het
Rasef C T 4: 73,740,581 V463M probably benign Het
Rb1 T C 14: 73,282,974 S42G unknown Het
Reep3 C A 10: 67,039,577 V36F probably damaging Het
Rhcg A G 7: 79,598,968 probably null Het
Sbno1 T C 5: 124,395,931 S661G probably benign Het
Slc25a3 T G 10: 91,122,328 Q50P possibly damaging Het
Slc2a13 T A 15: 91,343,805 I395F probably benign Het
Slc6a5 C T 7: 49,910,243 probably benign Het
Snta1 G C 2: 154,378,067 T391S possibly damaging Het
Spata7 T C 12: 98,663,220 probably null Het
Stx17 A G 4: 48,158,809 probably null Het
Terf2 A T 8: 107,076,854 S365T probably benign Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trim8 A T 19: 46,502,907 H155L probably benign Het
Wipi2 T A 5: 142,655,938 V83D probably damaging Het
Zfp316 C A 5: 143,254,884 R460L possibly damaging Het
Zfp651 T G 9: 121,763,659 D348E probably benign Het
Zfp947 A T 17: 22,146,414 I93N probably damaging Het
Zranb3 A G 1: 128,040,957 Y74H probably benign Het
Other mutations in Zfp799
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Zfp799 APN 17 32821820 missense possibly damaging 0.73
P0016:Zfp799 UTSW 17 32819357 missense possibly damaging 0.79
R0116:Zfp799 UTSW 17 32821035 missense possibly damaging 0.96
R0326:Zfp799 UTSW 17 32820726 missense possibly damaging 0.73
R1487:Zfp799 UTSW 17 32820677 missense possibly damaging 0.85
R1863:Zfp799 UTSW 17 32819400 missense probably damaging 1.00
R1929:Zfp799 UTSW 17 32821803 missense probably damaging 1.00
R1983:Zfp799 UTSW 17 32822110 missense probably damaging 1.00
R2127:Zfp799 UTSW 17 32819498 missense possibly damaging 0.80
R2271:Zfp799 UTSW 17 32821803 missense probably damaging 1.00
R2697:Zfp799 UTSW 17 32820240 nonsense probably null
R5134:Zfp799 UTSW 17 32820441 missense probably damaging 1.00
R5613:Zfp799 UTSW 17 32819990 missense probably damaging 0.98
R5839:Zfp799 UTSW 17 32822112 missense probably null 0.99
R6389:Zfp799 UTSW 17 32820578 missense probably damaging 1.00
R6475:Zfp799 UTSW 17 32820846 missense probably damaging 0.99
R6593:Zfp799 UTSW 17 32819790 missense probably damaging 1.00
R7133:Zfp799 UTSW 17 32820236 missense probably benign 0.19
R7543:Zfp799 UTSW 17 32820560 missense probably benign 0.11
R7883:Zfp799 UTSW 17 32820282 missense probably damaging 1.00
R7889:Zfp799 UTSW 17 32819499 nonsense probably null
R7966:Zfp799 UTSW 17 32820282 missense probably damaging 1.00
R7972:Zfp799 UTSW 17 32819499 nonsense probably null
Z1176:Zfp799 UTSW 17 32820216 nonsense probably null
Z1177:Zfp799 UTSW 17 32830219 start gained probably benign
Z1177:Zfp799 UTSW 17 32830221 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCTTGCATACATAGGGTTTCTCTC -3'
(R):5'- AAGACCTTTGCCCGTTCGAG -3'

Sequencing Primer
(F):5'- CCACTATGCATCAATTCATGGTAC -3'
(R):5'- CTGCTGACGCATGAGAGGATTC -3'
Posted On2018-05-04